last-split: catch spliced-alignment math overflow default tip
authorMartin C. Frith
Fri Jul 31 16:21:50 2020 +0900 (11 days ago)
changeset 1080de7890c559b8
parent 1079 5aaae537a930
last-split: catch spliced-alignment math overflow
src/split/cbrc_split_aligner.cc
test/last-split-test.out
test/last-split-test.sh
test/spliceWithGap.maf
     1.1 --- a/src/split/cbrc_split_aligner.cc	Fri Jul 31 15:53:49 2020 +0900
     1.2 +++ b/src/split/cbrc_split_aligner.cc	Fri Jul 31 16:21:50 2020 +0900
     1.3 @@ -13,6 +13,8 @@
     1.4  #include <sstream>
     1.5  #include <stdexcept>
     1.6  
     1.7 +#include <float.h>
     1.8 +
     1.9  static void err(const std::string& s) {
    1.10    throw std::runtime_error(s);
    1.11  }
    1.12 @@ -696,6 +698,11 @@
    1.13  	    if (alns[i].qend == j) p += endprob;
    1.14  	    p = p * Sexp[ij*2-1] * rescale;
    1.15  
    1.16 +	    // XXX p can overflow to inf.  This can happen if there is
    1.17 +	    // a large unaligned part in the middle of the query
    1.18 +	    // sequence.  Then, in forwardSplice, Fmat may underflow
    1.19 +	    // to 0, so the subsequent rescales are all 1.
    1.20 +
    1.21  	    Bmat[ij - 1] = p;
    1.22  	    //if (alns[i].qstart == j-1) zB += p;
    1.23  	    pSum += p * spliceEndProb(ij - 1);
    1.24 @@ -713,7 +720,9 @@
    1.25    unsigned j = queryBeg;
    1.26    for (unsigned pos = alnBeg; pos < alnEnd; ++pos) {
    1.27      size_t ij = matrixRowOrigins[i] + j;
    1.28 -    if (alns[i].qalign[pos] == '-') {
    1.29 +    if (Bmat[ij] > DBL_MAX) {  // can happen for spliced alignment
    1.30 +      output.push_back(0);
    1.31 +    } else if (alns[i].qalign[pos] == '-') {
    1.32        double value = Fmat[ij] * Bmat[ij] * Sexp[ij*2] * cell(rescales, j);
    1.33        output.push_back(value);
    1.34      } else {
    1.35 @@ -1113,6 +1122,7 @@
    1.36  }
    1.37  
    1.38  double SplitAligner::spliceSignalStrandLogOdds() const {
    1.39 +  // XXX if Bmat overflowed to inf, then I think this is unreliable
    1.40    assert(rescales.size() == rescalesRev.size());
    1.41    double logOdds = 0;
    1.42    for (unsigned j = 0; j < rescales.size(); ++j) {
     2.1 --- a/test/last-split-test.out	Fri Jul 31 15:53:49 2020 +0900
     2.2 +++ b/test/last-split-test.out	Fri Jul 31 16:21:50 2020 +0900
     2.3 @@ -46939,3 +46939,137 @@
     2.4  s chr3 23607556 23 + 198295559 ACGTTCTGGTTTATGTTTCCTTG
     2.5  s 102       673 23 +       699 ACGTTCTGGTTTATGTTTCCTTG
     2.6  
     2.7 +# LAST version 1066
     2.8 +#
     2.9 +# a=15 b=4 A=16 B=4 e=160 d=127 x=159 y=46 z=159 D=1e+06 E=148.452
    2.10 +# R=01 u=0 s=2 S=1 M=0 T=0 m=1 l=1 n=1 k=1 w=1000 t=4.57306 j=3 Q=0
    2.11 +# /home/mcfrith/data/genome/hg38/last/hg38naas-NEAR
    2.12 +# Reference sequences=195 normal letters=2934876451
    2.13 +# lambda=0.221681 K=0.376308
    2.14 +#
    2.15 +#     A   C   G   T   M   S   K   W   R   Y   B   D   H   V
    2.16 +# A   6 -23  -9 -23   3 -12 -12   3   3 -23 -14   1   1   1
    2.17 +# C -20   6 -23 -16   3   3 -18 -18 -21   3   1 -19   1   1
    2.18 +# G -10 -23   6 -23 -13   3   3 -13   3 -23   1   1 -15   1
    2.19 +# T -23 -14 -22   6 -17 -16   3   3 -22   3   1   1   1 -18
    2.20 +# M   3   3 -12 -18   3   0 -14   0   0   0  -2  -2   1   1
    2.21 +# S -13   3   3 -18   0   3   0 -15   0   0   1  -2  -2   1
    2.22 +# K -13 -17   3   3 -14   0   3   0   0   0   1   1  -2  -2
    2.23 +# W   3 -17 -12   3   0 -14   0   3   0   0  -2   1   1  -2
    2.24 +# R   3 -23   3 -23   0   0   0   0   3 -23  -2   1  -2   1
    2.25 +# Y -21   3 -22   3   0   0   0   0 -22   3   1  -2   1  -2
    2.26 +# B -14   1   1   1  -2   1   1  -2  -2   1   1  -1  -1  -1
    2.27 +# D   1 -18   1   1  -2  -2   1   1   1  -2  -1   1  -1  -1
    2.28 +# H   1   1 -14   1   1  -2  -2   1  -2   1  -1  -1   1  -1
    2.29 +# V   1   1   1 -19   1   1  -2  -2   1  -2  -1  -1  -1   1
    2.30 +#
    2.31 +# Coordinates are 0-based.  For - strand matches, coordinates
    2.32 +# in the reverse complement of the 2nd sequence are used.
    2.33 +#
    2.34 +# name start alnSize strand seqSize alignment
    2.35 +#
    2.36 +# m=1 s=181 d=1 c=0.004 t=1e-05 M=7 S=1.7
    2.37 +# trans=-156
    2.38 +# cismax=4325875
    2.39 +#
    2.40 +# Query sequences=1
    2.41 +a score=223 mismap=1
    2.42 +s chr2          214812953 45 + 242193529 aaaaaaaaaaaaaaaaaaacacaaaaggaaaagaaagaaaaagaa
    2.43 +s spliceWithGap      7121 44 -      7262 aaaaaaaaaaaaaaaaaaacacaaaaggaaaa-aaaaaaaaagAA
    2.44 +p                                        !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    2.45 +
    2.46 +a score=12380 mismap=1
    2.47 +s chr6          42691031 2474 + 170805979 ACGGGGAAATCCTTTACA-TTTATGCAAAGAGCGATTCAAGAAGAT----TCAGAAGCTCTGGCACCAACACAGTGTCACAGAGGAAATTG---GACATGCACAGGAAGCCAATCAGACACTGGTTGGCATTGACTGGCAACATTTATAATTATTGCACCACCAAAAAACACAAACTTGGATTTTTTTAACCCAGTTGGCTTTTTAAGAAAGAAAGAAGTTCTGCTGAATTTGGAAATAAATTCTTTATTTAAACTTTCCTTCCCAGTTTTATAGTTTCTGGTTCTGAGGACTGATGAAAATCATCTTCCATCAGCAGATTTTCTTGCACTGTTTGCTGTGCCCC-TCAAATATAATGTCTTGGGTTTTAAGATCGAGCAAGGAGCTTCTCTTCCTAGATTGGATCCCAGCCCCTTTGTGGGGGTCTGACTGCATAGTCCCAGCCATTATGTGATATTTCACGTTATTGATGATAGTGAACCGTGGGTCCGAAGCTGACTCAACGGAGGCAGGGAACAAAGTCTCTGTGGTCTGTTGGGTCATACTTCCTGGTTCCACTGAGTGGCCCAACACTGGGACTGGGTTGGTGTCCCCTCTGCTGACAGGACCCTACTCCTAGGAGCAAAGTGGTTGATTTTGAAGGCAGTGTTCCCTTCTCTCCATTGACTATGAGAGAGTTGGGGGACACACATGCAGAAGAAGCCCGTGGGGAGAAGGTGGATT-CCTGGTGTGCT--GGCTGGTTTTTCAGGGCTGTTAGAGGTtttt---tttttttctttttttttttATGGCAAGACTTTTGGC-TTTGAGAAAACTCACTTAGAGGGCTTTCCAAAAACTTAGGATGGtct-aaaaaattaggatattc-tTTTAGAATTAGGAAGaaaaattaggatattctaaaagaatatggattaaaaatttaggatattcttttagaTATCCTAATATCTAGATGAGAGGCCTTCCTTCATAAGATCTGGTTGTTTGGGCTGTGGTTGGCATAAGTGATATTTATTTTGGCCTCTGTCACATCCAGTTTCT-TGAGCTTTTAAGGTAAGCTTCTTTTGGCTTTTTTTCAGATGTTCACCAAGCTTAAGTTTAAAATAATAGGTATTCT-AAAAG-AGTATCCTAATTTTCTTAtctgtattcttttagaataccc-taatgtt-TCAGACAGTGATATTCTCTTGTTATTTCTAAGGCTAAATTGGCAGAGTATATCATCTAAAGCCAAACACTGAAGAAGGTGAGAACCCA-CTCCCAcccagccagCATTTCCTGGAACAGACAAGCTGCTGCTTCCTTGCTGGCTCACTTAGTGCATTCCTGGGATGGTCTGGCACCCA--GGCTTTTTATTCTTTTTGATCATTGTTCTTACTGAGGTGCCTTCCTAGAACAAGAGCCACTTA--CAAAATAGCTTATAATTATTATGTACCACACAACTACTATTGTTTGATGTATGACTGCTGAGAGCTTGAATACATGCAGAGAGTGACTGAAGACTTAGT--AGAGGAATAAATTCTGAGCCTGTCTAAGGTGGGGCTAAGGAACAGATGAGTAATAAGAG--GCTCTTGGATTTTTTTAACCAATGCAACTGACCCTTTCAATCAGTTTTC-TTTGAA-TTACATCTACAAGTTTTGTTCCACTCAGCTACCAGTCAACTAGGCATGC------TCCACAGTATCACAGGAAGAAGGTCAGAAATCTGGAACTGAAGCTAAAAGAAGTGAGGATGTAGAAGCCACATTCC-TCTCCAAGGTAGTGTGTGAAAGAACCGCCCCCTCTTGACAGGAGGATGACCGTCGCCATTCTTGCGTGGGACTGACTCACCCAGCT-GAGAGGAGGACCAATAGAAAGAAAATTCACATTTGAGTCCACCTCTCTCCCCCTTTTTCTGGCCTTCATTCATAAGATCTGGTTGTTTGGGCTGTAGGTGGCATAATTCATGTTTATTTTGGCCTCTGTCACATC----CAGTTTCTTTAGCTTTTAAGGTAAGCTTCTTTTGGCTTTTTTTCATATGTTCACCAAGCTAAAATTTAAAATAATAAGACCAGGTT--TCTCTCTGTAC-AAGTGGATTATAAACA-TTTTCACCAAATCATAACAATACTCCAGCTTTCCGGTCCGACTTCCTAGGAGCCTGGAGTTAGCAAAGGTTGTC-TCTGGATTTCATTCTCTGAGAATATCACAGAGCCTGGGAGAAGATGAATTTACATGAAATTGCAACATACACACCTTTTTATTTTCTGGTGTTAAGCTAGTTGTCTTTCCTACCTTACAAATCATGTTAGTTTTATGATTTGTTCCGCATGTTTTATGTTTATTGTAGAAATGTT--TATATAACATACGCTTTCCATATCAGGG-AAAATCATATCTGTTTAATAAATTGGCTATAACTTTAATATCTGTGGAC-AACTTGTAAAATTTGGAATGTATCATATGTAAAAAGTTTAAAGATATCCAAATAAATGCTTTAGGTGTTGGCATTA
    2.48 +s spliceWithGap     4647 2474 -      7262 ACGGGGAAATCCTTTACAGTTTATGCAAAGAGCGATTCAAGAAGATCTTGT--GAAG-TCTGGCACCAACACAGTGTCACAG--------GCCTGACATGCACAGGAAGCCAATCAGACACTGGTTGGCATTGACTGGCAACATTTATAATTATTGCACCACCAAAA--CACAAACTTGGATTTTA--AACCCAGTTGGCTTTT-AAGAAAGAAAGAAGTTCTGCTGAATTTGGAAATAAATTCTTTATTTAAACTTTCCTTCCCAGTTTTATAGTTTCTGGTTCTGAGGACTGATGAAAATCATCTTCCATCAGCAGATTTTCTTGCACTGTTTGCTGTGCCCCCTCAAATATAATGTCTTGGGTTTTAAGATCGAGCAAGGAGCTTCTCTTCCTAGATTGGATCCCAGCCCCTT-GTGGGG-TCTGACTGCATAGTCCCAGCCATTATGTGATATTTCACGTTATTGATGATAGTGAACTGTGGGTCCGAAGCTGACTCAACGGAGGCAGGGAACAAAGTCTCTGTGGTCTGTTGGGTCATACTTCCTGGTTCCACTGAGTGGCCCAACACTGGGACTGGGTTGGTGTCCCCTCTGCTGACAGGACCCTACTCCTAGGAGCAAAGTGGTTGATTTTGAAGGCAGTGTTCCCTTCTCTCCATTGACTATGAGAGAGTTGGGGGACACACATGCAGAAGAAGCCCGTGGG-AGAAGGTGGATTCCCTGGTGTGTTAAGGTTTCTTTTTCAGGGCTGTTAGAGGTttttttctttttttttttttttttttATGGCAAGACTTTTGGCTTTTGAGAAACCTCACTTAGAGGGCTTTCC-AAAACTTAGGATGGTCTAAAaaaattat--tattcttttTAGAATTA-GAAG-aaaattaggatattctaaaagaatATGGATTAAaaatttaggatattc-tTTAGATATCCTAATATTCAGATGAGAGGCC-TCCTTCATAAGATCTGGTTGTTTGGGCTGTGGTTGGCATAAGTGATATTTATTCTGGCCTCTGTCACATCCAGTTTCTCTGAGCTTTTAAGGT--GCTTCTTTTGGCTTTTTTTCAGATGTTCACT--GCTTAAGTTTAAAATAATAGGTATTCTAAAAAGCAGCATCCTAATTTTCTTATCTTCATTC-TTTAGAATACCCTTAATGTTCTCAGACAGTGATAT--TCTTGTTATTTCTAAGGCTAAATTGGCAGAGTATATCATCTAAAGCCAAACACTGAAGAAGGTGAGAACCCATCTCCCACCCAGCCAGCATTTCCTGGAACAGACAAGCTGCTGCTTCCTTGCTGGCTCACTTAGTGCATTCCTGGGATGGTCTGGCACCCAGCGGTTTTTTATTC-TTTTGATCATTGTTCTTACTGAGGTGCCTTCCTAGAACAAGAGCCACTCAAGCAAAATAGCTTATAATTATTATGTACCACAC----ACTATTGTTTGATGTATGACTGCTGAGAGCTTGAATACATGCAGAGAGTGACTGAAGACATAGTTAAGAGGAATAAATTTTGAGCCCGTCTAAGGTGGGGCTAAGGAACAGATGAGTAATAAGAGGTGCTCTT-GA---TCTTAACCAATGCAACTGACCCTTTCAATCAGTTTTCTTTTGAATTTACATCTACAAGTTTTGTTCCACTCAGCTACCAGTCAACTAGGCATGCCCTTGGT---CAGTATCACAGGAAGAAGGTCAGGAATCT-GAACTGAAGCTAAAAGAAGTGAGGATGTAGAAGCCACATTCCTTCTTCAAGGTAGTGTGTGAAAGAACTGCCCCCTCTTGACAGGAGGATGACTGTCGCCATTCTGGTGTGGGACTGACTCACCCAGCTGGAGAGGAGGACCAATAGAAAGAAAATTCACATTTGAGTCCAC--CTCTCCCCCTTTTTCTGGCCTTCATTCATAAGATCTGGTTGTTTGGGCTGTAGGTGGTACAATTCATGTTTA-TTTGGCCCCTGT--CATCCTTACAGTTTCTTTAGCTTTTAAGGTAAGCTTCTTTTGGC-TTTTTTCATATGTTCACCAAGCTAAAATTTAAAATAATAAGACCAGGTTTCTCTCTCTGTACAAAG-GGATTATAAACATTTTTCACCAAATCATAACAATACTCCAGCTTTCCGGTCCGACTTCCTAGGAGCCTGGGGTTAGCAAAGGTTGTCTTCT-GATTTCATTCTCTGAGAATATCACAGAGCCTGGGAGAAGATGAATTTACATGAAATTGCAACATACACACCTTTTTATTTTCTGGTGTTAAGCTAGTTGTCTTTCCTACCTTACAAATCATGTTAGCCTTATGATTTGTTCCGCATGTTTTATGTTTGCTGTAGAAATGTTTCTATATAATATACGCTTTCCATATCAGGGAAAAATCATATCTGTTTAATAAATTGGCTATAACTTTAATATCTGTGGACAAACTTGTAAAATTT-GAATGTATCATATGTAAAAAGTTTAAAGATATCCAAATAAATGCTTTAGGTGTTGGCATTA
    2.49 +p                                         !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    2.50 +
    2.51 +a score=544 mismap=1
    2.52 +s chr6          42689566 104 + 170805979 AGAGTACGGGAATGTCAGGTGCTATTT-TTAGCTGGCAAAACCAAAGGCTGTTTTTATTCTCCTCCTTACCTTGATGACTATGGGGAGACCGACCA-GGGACTCAG
    2.53 +s spliceWithGap     4541 106 -      7262 AGAGTACGGGAATGTCAGGTGCTGTTTCTTAGCTGGCAAAACCAAAGGCTGTTTTTATTCTCCTCCTTACCTTGATGACTATGGGGAGACCGACCGTGGGACTCAG
    2.54 +p                                        !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    2.55 +
    2.56 +a score=934 mismap=1
    2.57 +s chr6          42688217 165 + 170805979 GCCCGAAATCAGGTGGTGATAAGAGCAGAGCCCCAACTCTGTGCCTTGTGTGCGGATCTCTGCTGTGCTCCCAGAGTTACTGCTGCCAGACTGAACTGGAAGGGGAGGATGTAGGAGCCTGCACAGCTCACACCTACTCCTGTGGCTCTGGAGTGGGCATCTTCC
    2.58 +s spliceWithGap     4374 164 -      7262 GCCCGAAATCAGGTGGTGATAAGAGCAGAGCCCCAATCCTGTGCCTTGTGTGCGGATCTCTGCTGTGC-CCCAGAGTTACTGCTGCCAGACTGAACTGGAAGGGGAGGATGTAGGAGCCTGCACAGCTCACACCTACTCCTGTGGCTCTGGAGTGGGCATCTTCC
    2.59 +p                                        !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    2.60 +
    2.61 +a score=480 mismap=1
    2.62 +s chr6          42684793 80 + 170805979 ATATCCAAGAGAATCTAACAAATTAATAAACCTTCCAGAGGATTACAGCAGCCTCATTAATCAAGCATCCAATTTCTCGT
    2.63 +s spliceWithGap     4294 80 -      7262 atatcCAAGAGAATCTAACAAATTAATAAACCTTCCAGAGGATTACAGCAGCCTCATTAATCAAGCATCCAATTTCTCGT
    2.64 +p                                       !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    2.65 +
    2.66 +a score=342 mismap=1
    2.67 +s chr6          42683054 57 + 170805979 TTGGTGCCGTAACAGTGAAGTTAAAAGATATCTAGAAGGTGAAAGAGATGCTATAAG
    2.68 +s spliceWithGap     4237 57 -      7262 TTGGTGCCGTAACAGTGAAGTTAAAAGATATCTAGAAGGTGaaagagatgctataag
    2.69 +p                                       !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    2.70 +
    2.71 +a score=630 mismap=1
    2.72 +s chr6          42679723 109 + 170805979 TTCCTGGAACAAGCCATTTTGAACATTTATGTAGCTATCTTTCCCTACCAAACAACCTCATTTGCCTTTTTCAAGAAAA--TAGTGAGATAATGAATTCACTGATTGAAAG
    2.73 +s spliceWithGap     4126 111 -      7262 TTCCTGGAACAAGCCATTTTGAACATTTATGTAGCTATCTTTCCCTACCAAACAACCTCATTTGCCTTTTTCAAGAAAAAATAGTGAGATAATGAATTCACTGATTGAAAG
    2.74 +p                                        !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    2.75 +
    2.76 +a score=721 mismap=1
    2.77 +s chr6          42678538 131 + 170805979 TGCCTTGAAAGAAATACCATCCGGCTGGCATCTGTGGAGGAGTGTCAGAGCTGGAATCATGCCTTTCCTG-AAGTGTTCTGCTTTATTTTTTCATTACTTAAATGGAGTTCCTTCCCCACCCGACATTCAAG
    2.78 +s spliceWithGap     3997 129 -      7262 TGCCTTGAAAGAAATACCATCCGGCTGGCATCTGTGGAGGAGTGTCAGAGCTGGAATCATGCCTTTCCTGGAAGTGTTCTGCTTTATTTTTTCATTACTTAAATGGAGTTCCTT---CACCCGACATTCAAG
    2.79 +p                                        !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    2.80 +
    2.81 +a score=397 mismap=1
    2.82 +s chr6          42676782 91 + 170805979 AAGAGAATGGCATGGATCAAGAAAATCCCCCTTGTGAAGAAGAATCAGCAGTTCTTGCTTTGTATAAAACACTTCACCAGTATACGGGAAG
    2.83 +s spliceWithGap     3907 90 -      7262 AAGAGAATGCCATGGATCAAGAAAAATCCCCTTGTGC-GAAGAATCAGCAGTTCTTGCTTTGTATAAAACACTTCACCAGTATACGGAAAG
    2.84 +p                                       !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    2.85 +
    2.86 +a score=671 mismap=1
    2.87 +s chr6          42676060 131 + 170805979 CTTGGTGCTTGCATT-TC-CTGCGTTGCAG------TGTCAGGATTTTTCAGGGATCAGCCTTGGCACTGGAGACCTTCACATTTTCCATCTGGTTACTATGGCACACATCATACAGATCTTACTTACCTCATGTACAG
    2.88 +s spliceWithGap     3770 137 -      7262 CTTGGTGCTTGCATTCTCTCTGCGTTGCAGCAAGTTTGT--GGATTTTTCAGGGATCAGCCTTGGCACTGGAGACCTTCACATTTTCCATCTGGTTACTATGGCACACATCATACAGATCTTACTTACCTCATGTACAG
    2.89 +p                                        !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    2.90 +
    2.91 +a score=438 mismap=1
    2.92 +s chr6          42674125 73 + 170805979 CACTGGTGCCTAATGACAGCCATGAGGAACTTCCATGCATATTAGATATTGACATGTTTCATTTATTGGTGGG
    2.93 +s spliceWithGap     3697 73 -      7262 CACTGGTGCCTAATGACAGCCATGAGGAACTTCCATGCATATTAGATATTGACATGTTTCATTTATTGGTGGG
    2.94 +p                                       !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    2.95 +
    2.96 +a score=432 mismap=1
    2.97 +s chr6          42673791 96 + 170805979 ATGACTGTCTTAGGTCATTGACGAGATTT--GCCGCAGCACACTGGACAGTGGCATCAGTTTCAGTGGTGCAAGGACATTTTTGTAAACTTTTTGCAT
    2.98 +s spliceWithGap     3605 92 -      7262 ATGACTGTCTTAGGTCATTGACGAGATTTTTGCCGCAGCAC--TGGACAG---CACCAGTTTCAGTGGTGCAAGGACATTTTTGTAAACTTTT-GCAT
    2.99 +p                                       !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
   2.100 +
   2.101 +a score=317 mismap=1
   2.102 +s chr6          42670659 57 + 170805979 AAAGAATTTTGAGTGATGAAGATAAACCATTGTTTGGTCCTTTACCTTGCAGACTGG
   2.103 +s spliceWithGap     3549 56 -      7262 AAAGAATTTTGAGTGATGAAGATAAACCATTGTTTG-TCCTTTACCTTGCAGACTGG
   2.104 +p                                       !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
   2.105 +
   2.106 +a score=813 mismap=1
   2.107 +s chr6          42670097 143 + 170805979 TTATTCTGAGAGCATAAAAGAAATGCTAACGACATTTGGAACTGCTACCTACAAGGTGGGACTAAAGGTTCATCCCAATGAAGAGGATCCTCGTGTTCCCATAATGTGTTGGGGTAGCTGCGCGTACACCATCCAAAGC-ATAG
   2.108 +s spliceWithGap     3406 143 -      7262 TTATTCTGAGAGCATAAAAGAAATGCTAACGACATTT-GAACTGCTACCTACAAGGTGGGACTAAAGGTTCATCCCAATGAAGAGGATCCTCGTGTTCCCATAATGTGTTGGGGTAGCTGCGCGTACACCATCCAAAGCGATAG
   2.109 +p                                        !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
   2.110 +
   2.111 +a score=437 mismap=1
   2.112 +s chr6          42666167 77 + 170805979 TAATGCCTCTACAAAGAATTCAGAAAATGTGGATGAATTACAGCTCCCTGAAGGGTTCAGGCCTGATTTTCGTCCTA
   2.113 +s spliceWithGap     3327 76 -      7262 TAATGCCTCTACAAAGAATTCAGAAAATGT-GATGAATTACAGCTCCCTGAAGGGTTCAGGCCTGATTTTCGTCCTA
   2.114 +p                                       !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
   2.115 +
   2.116 +a score=511 mismap=1
   2.117 +s chr6          42665408 96 + 170805979 CAGGTTAAATTTTTCAGACCAACCAAATCTGA-CTCAGTGGATTAGAACAATATCTCAGCAAATAAAAGCATTACAGTTTCTTAGGAAAGAAGAAAG
   2.118 +s spliceWithGap     3221 96 -      7262 CAGGTTAAATTTTTCAGACCAACCAAATCTGGGCTCAGTGGATTAGAACAATATCTCAGCAAATAAAAGCATTACAGTTTCTTAG-AAAGAAGAAAG
   2.119 +p                                       !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
   2.120 +
   2.121 +a score=800 mismap=1
   2.122 +s chr6          42663260 159 + 170805979 TTTTGATTCCGTTCAAGCTAAAGAACA--GCGAAGGCAACA-GAGATTACGCTTACATACGAGCTATGATGTAGAAAACGGAGAATTCCTTTGCCCCCTTTGTGAATGCTTGAGTAATA---CTGTTATTCCTCTGCTGCTTCCTCCAAGAAATATTTTTAACAA
   2.123 +s spliceWithGap     3057 163 -      7262 TTTTGATTCCGTTCAAGCTAAAGAACAAAGTGAAGGCAACAGGAGATTACGCTTACATACGAGCTATGATGTAGAAAACGGAGAATTCCTTTGCCCCCTTTGTGAATGCTTGAGCAA--GGCCTGTTATTCCTCTGTTGCTTCCTCCAAGAAATATTTTTAACAA
   2.124 +p                                        !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
   2.125 +
   2.126 +a score=547 mismap=1
   2.127 +s chr6          42662183 97 + 170805979 AAAAATATGATCCATTATTCATGCACCCTGATCTGTCTTGTGGAACACACACTAGTAGCTGTGGGCACATTATGCATGCCCATTGTTGGCAAAGGTA
   2.128 +s spliceWithGap     2962 95 -      7262 AAAAATATGATCCATTATTCATGCACCCTGATCTGTCTTGTGGAACACAC--TAGTAGCTGTGGGCACATTATGCATGCCCATTGTTGGCAAAGGTA
   2.129 +p                                       !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
   2.130 +
   2.131 +a score=1123 mismap=1
   2.132 +s chr6          42659655 200 + 170805979 CCCTGTGGCTTCAGATATGACACTTACAGCACTGGGCCCC-GCACAAACTCAGGTTCCTGAACAAAGACAATTCGTTACATGTATATTGTGTCAAGAGGAGCAAGAAGTTAAAGTGGAAAGCAGGGCAATGGTCTTGGCAGCATTTGTTCAGAGATCAACTGTATTATC-AAAAAACAGAAGTAAATTTATTCAAGATCCAG
   2.133 +s spliceWithGap     2760 202 -      7262 CCCTGTGGCTTCAGATATGACACTTACAGCACTGGGCCCCCACACAAACTCAGGTTCCTGAACAAAGACAATTCGTTACATGTATATTGTGTCAAGAGGAGCAAGAAGTTAAAGTGGAAAGCAGGGCAATGGTCTTGGCAGCATTTGTTCAGAGATCAACCGTATTATCAAAAAAACAGAAGTAAATTTATTCAAGATCCAG
   2.134 +p                                        !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
   2.135 +
   2.136 +a score=342 mismap=1
   2.137 +s chr6          42658730 94 + 170805979 CTGAAATGCA-GCGGCATTTTA--TTGA---TGAAAACAAAGAACTCTTTCAGCAGACATTAGAACTGGATGCCTCAACCTCTGCTGTTCTTGATCATAG
   2.138 +s spliceWithGap     2662 98 -      7262 CTGAAATGCATGCAG-ATTTGAGTTTGAGGCTGAAAACAGTGAACT-TTTCAGCAGACATTAGAACTGGATGCCTCAACCTCTGCTGTTCTTGATCATAG
   2.139 +p                                       !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
   2.140 +
     3.1 --- a/test/last-split-test.sh	Fri Jul 31 15:53:49 2020 +0900
     3.2 +++ b/test/last-split-test.sh	Fri Jul 31 16:21:50 2020 +0900
     3.3 @@ -31,5 +31,6 @@
     3.4  
     3.5      last-split 102.maf
     3.6      last-split -fMAF 102.maf
     3.7 -} |
     3.8 -diff -u last-split-test.out -
     3.9 +
    3.10 +    last-split -d1 spliceWithGap.maf
    3.11 +} | diff -u last-split-test.out -
     4.1 --- /dev/null	Thu Jan 01 00:00:00 1970 +0000
     4.2 +++ b/test/spliceWithGap.maf	Fri Jul 31 16:21:50 2020 +0900
     4.3 @@ -0,0 +1,263 @@
     4.4 +# LAST version 1066
     4.5 +#
     4.6 +# a=15 b=4 A=16 B=4 e=160 d=127 x=159 y=46 z=159 D=1e+06 E=148.452
     4.7 +# R=01 u=0 s=2 S=1 M=0 T=0 m=1 l=1 n=1 k=1 w=1000 t=4.57306 j=3 Q=0
     4.8 +# /home/mcfrith/data/genome/hg38/last/hg38naas-NEAR
     4.9 +# Reference sequences=195 normal letters=2934876451
    4.10 +# lambda=0.221681 K=0.376308
    4.11 +#
    4.12 +#     A   C   G   T   M   S   K   W   R   Y   B   D   H   V
    4.13 +# A   6 -23  -9 -23   3 -12 -12   3   3 -23 -14   1   1   1
    4.14 +# C -20   6 -23 -16   3   3 -18 -18 -21   3   1 -19   1   1
    4.15 +# G -10 -23   6 -23 -13   3   3 -13   3 -23   1   1 -15   1
    4.16 +# T -23 -14 -22   6 -17 -16   3   3 -22   3   1   1   1 -18
    4.17 +# M   3   3 -12 -18   3   0 -14   0   0   0  -2  -2   1   1
    4.18 +# S -13   3   3 -18   0   3   0 -15   0   0   1  -2  -2   1
    4.19 +# K -13 -17   3   3 -14   0   3   0   0   0   1   1  -2  -2
    4.20 +# W   3 -17 -12   3   0 -14   0   3   0   0  -2   1   1  -2
    4.21 +# R   3 -23   3 -23   0   0   0   0   3 -23  -2   1  -2   1
    4.22 +# Y -21   3 -22   3   0   0   0   0 -22   3   1  -2   1  -2
    4.23 +# B -14   1   1   1  -2   1   1  -2  -2   1   1  -1  -1  -1
    4.24 +# D   1 -18   1   1  -2  -2   1   1   1  -2  -1   1  -1  -1
    4.25 +# H   1   1 -14   1   1  -2  -2   1  -2   1  -1  -1   1  -1
    4.26 +# V   1   1   1 -19   1   1  -2  -2   1  -2  -1  -1  -1   1
    4.27 +#
    4.28 +# Coordinates are 0-based.  For - strand matches, coordinates
    4.29 +# in the reverse complement of the 2nd sequence are used.
    4.30 +#
    4.31 +# name start alnSize strand seqSize alignment
    4.32 +#
    4.33 +# batch 0
    4.34 +a score=216 EG2=0.0006 E=2.6e-08
    4.35 +s chr14         49704362 45 + 107043718 TCTttttattttttttccttttctgtttttttttttttttttttt
    4.36 +s spliceWithGap       98 44 +      7262 TCTtttt-ttttttttccttttgtgtttttttttttttttttttt
    4.37 +
    4.38 +a score=197 EG2=0.041 E=1.7e-06
    4.39 +s chr5          53000873 45 + 181538259 TTCttttttttctttttctttttgttttttttttttttttttttt
    4.40 +s spliceWithGap       97 44 +      7262 TTCTttttttt-tttttccttttgtgttttttttttttttttttt
    4.41 +
    4.42 +a score=186 EG2=0.47 E=2e-05
    4.43 +s chr15         96899561 31 + 101991189 CCATAaaaaaaaaaaaaaaaaaagaaaaaaa
    4.44 +s spliceWithGap     1840 31 +      7262 CCATAaaaaaaaaaaaaaaaaaagaaaaaaa
    4.45 +
    4.46 +a score=180 EG2=1.8 E=7.5e-05
    4.47 +s chr14         89975575 30 + 107043718 TTtgtgttttttttttttttttttttAATG
    4.48 +s spliceWithGap      116 30 +      7262 tttgtgttttttttttttttttttttAATG
    4.49 +
    4.50 +a score=180 EG2=1.8 E=7.5e-05
    4.51 +s chr7          139266226 30 + 159345973 Aaaaaaaaaaaaaaaaaaagaaaaaaacct
    4.52 +s spliceWithGap      1844 30 +      7262 AaaaaaaaaaaaaaaaaaagaaaaaaaCCT
    4.53 +
    4.54 +a score=180 EG2=1.8 E=7.5e-05
    4.55 +s chr9          374443 30 + 138394717 TCCTTttgtgtttttttttttttttttttt
    4.56 +s spliceWithGap    112 30 +      7262 tccttttgtgtttttttttttttttttttt
    4.57 +
    4.58 +a score=175 EG2=5.3 E=0.00023
    4.59 +s chr14         50098199 34 + 107043718 GTCTTGCCAAaaaaaaaaaaaaaaaaaaagaaaa
    4.60 +s spliceWithGap     1834 34 +      7262 GTCTTGCCATAaaaaaaaaaaaaaaaaaagaaaa
    4.61 +
    4.62 +a score=171 EG2=13 E=0.00055
    4.63 +s chr16         88292798 31 + 90338345 AaaaaaaaaaaaaaaaaaaaaCCTCTAACAG
    4.64 +s spliceWithGap     1850 31 +     7262 aaaaaaaaaaaaagaaaaaaaCCTCTAACAG
    4.65 +
    4.66 +a score=170 EG2=16 E=0.00069
    4.67 +s chrY          25192029 31 + 57227415 aaaaaaaaaagaaaaaaaagaaaaaaaCCTC
    4.68 +s spliceWithGap     1844 31 +     7262 AaaaaaaaaaaaaaaaaaagaaaaaaaCCTC
    4.69 +
    4.70 +a score=169 EG2=20 E=0.00086
    4.71 +s chr9          103222739 33 + 138394717 AaaaaaaaaaaaaaaaaaagaaaaaaaactctA
    4.72 +s spliceWithGap      1844 33 +      7262 AaaaaaaaaaaaaaaaaaagaaaaaaaCCTCTA
    4.73 +
    4.74 +a score=166 EG2=39 E=0.0017
    4.75 +s chr11         65756025 35 + 135086622 TAaaaaaaaaaaaaaaaaaaaaaaaaaTCCTCTAA
    4.76 +s spliceWithGap     1843 35 +      7262 TAaaaaaaaaaaaaaaaaaagaaaaaaaCCTCTAA
    4.77 +
    4.78 +a score=164 EG2=61 E=0.0026
    4.79 +s chr20         55721155 30 + 64444167 AaaaaaaaaaaaaaaaagaagaaaACCTCT
    4.80 +s spliceWithGap     1846 30 +     7262 aaaaaaaaaaaaaaaaagaaaaaaaCCTCT
    4.81 +
    4.82 +a score=164 EG2=61 E=0.0026
    4.83 +s chrX          22098081 31 + 156040895 TTTCCTCTTGtgttttttttttttttttttt
    4.84 +s spliceWithGap      110 31 +      7262 tttccttttgtgttttttttttttttttttt
    4.85 +
    4.86 +a score=162 EG2=95 E=0.004
    4.87 +s chr9          122853376 27 + 138394717 ATaaaaaaaaaaaaaaaaaaagaaaaa
    4.88 +s spliceWithGap      1842 27 +      7262 ATAaaaaaaaaaaaaaaaaaagaaaaa
    4.89 +
    4.90 +a score=12392 EG2=0 E=0
    4.91 +s chr6          42691029 2476 + 170805979 AGACGGGGAAATCCTTTACA-TTTATGCAAAGAGCGATTCAAGAAGAT----TCAGAAGCTCTGGCACCAACACAGTGTCACAGAGGAAATTG---GACATGCACAGGAAGCCAATCAGACACTGGTTGGCATTGACTGGCAACATTTATAATTATTGCACCACCAAAAAACACAAACTTGGATTTTTTTAACCCAGTTGGCTTTTTAAGAAAGAAAGAAGTTCTGCTGAATTTGGAAATAAATTCTTTATTTAAACTTTCCTTCCCAGTTTTATAGTTTCTGGTTCTGAGGACTGATGAAAATCATCTTCCATCAGCAGATTTTCTTGCACTGTTTGCTGTGCCCC-TCAAATATAATGTCTTGGGTTTTAAGATCGAGCAAGGAGCTTCTCTTCCTAGATTGGATCCCAGCCCCTTTGTGGGGGTCTGACTGCATAGTCCCAGCCATTATGTGATATTTCACGTTATTGATGATAGTGAACCGTGGGTCCGAAGCTGACTCAACGGAGGCAGGGAACAAAGTCTCTGTGGTCTGTTGGGTCATACTTCCTGGTTCCACTGAGTGGCCCAACACTGGGACTGGGTTGGTGTCCCCTCTGCTGACAGGACCCTACTCCTAGGAGCAAAGTGGTTGATTTTGAAGGCAGTGTTCCCTTCTCTCCATTGACTATGAGAGAGTTGGGGGACACACATGCAGAAGAAGCCCGTGGGGAGAAGGTGGATT-CCTGGTGTGCT--GGCTGGTTTTTCAGGGCTGTTAGAGGTtttt---tttttttctttttttttttATGGCAAGACTTTTGGC-TTTGAGAAAACTCACTTAGAGGGCTTTCCAAAAACTTAGGATGGtct-aaaaaattaggatattc-tTTTAGAATTAGGAAGaaaaattaggatattctaaaagaatatggattaaaaatttaggatattcttttagaTATCCTAATATCTAGATGAGAGGCCTTCCTTCATAAGATCTGGTTGTTTGGGCTGTGGTTGGCATAAGTGATATTTATTTTGGCCTCTGTCACATCCAGTTTCT-TGAGCTTTTAAGGTAAGCTTCTTTTGGCTTTTTTTCAGATGTTCACCAAGCTTAAGTTTAAAATAATAGGTATTCT-AAAAG-AGTATCCTAATTTTCTTAtctgtattcttttagaataccc-taatgtt-TCAGACAGTGATATTCTCTTGTTATTTCTAAGGCTAAATTGGCAGAGTATATCATCTAAAGCCAAACACTGAAGAAGGTGAGAACCCA-CTCCCAcccagccagCATTTCCTGGAACAGACAAGCTGCTGCTTCCTTGCTGGCTCACTTAGTGCATTCCTGGGATGGTCTGGCACCCA--GGCTTTTTATTCTTTTTGATCATTGTTCTTACTGAGGTGCCTTCCTAGAACAAGAGCCACTTA--CAAAATAGCTTATAATTATTATGTACCACACAACTACTATTGTTTGATGTATGACTGCTGAGAGCTTGAATACATGCAGAGAGTGACTGAAGACTTAGT--AGAGGAATAAATTCTGAGCCTGTCTAAGGTGGGGCTAAGGAACAGATGAGTAATAAGAG--GCTCTTGGATTTTTTTAACCAATGCAACTGACCCTTTCAATCAGTTTTC-TTTGAA-TTACATCTACAAGTTTTGTTCCACTCAGCTACCAGTCAACTAGGCATGC------TCCACAGTATCACAGGAAGAAGGTCAGAAATCTGGAACTGAAGCTAAAAGAAGTGAGGATGTAGAAGCCACATTCC-TCTCCAAGGTAGTGTGTGAAAGAACCGCCCCCTCTTGACAGGAGGATGACCGTCGCCATTCTTGCGTGGGACTGACTCACCCAGCT-GAGAGGAGGACCAATAGAAAGAAAATTCACATTTGAGTCCACCTCTCTCCCCCTTTTTCTGGCCTTCATTCATAAGATCTGGTTGTTTGGGCTGTAGGTGGCATAATTCATGTTTATTTTGGCCTCTGTCACATC----CAGTTTCTTTAGCTTTTAAGGTAAGCTTCTTTTGGCTTTTTTTCATATGTTCACCAAGCTAAAATTTAAAATAATAAGACCAGGTT--TCTCTCTGTAC-AAGTGGATTATAAACA-TTTTCACCAAATCATAACAATACTCCAGCTTTCCGGTCCGACTTCCTAGGAGCCTGGAGTTAGCAAAGGTTGTC-TCTGGATTTCATTCTCTGAGAATATCACAGAGCCTGGGAGAAGATGAATTTACATGAAATTGCAACATACACACCTTTTTATTTTCTGGTGTTAAGCTAGTTGTCTTTCCTACCTTACAAATCATGTTAGTTTTATGATTTGTTCCGCATGTTTTATGTTTATTGTAGAAATGTT--TATATAACATACGCTTTCCATATCAGGG-AAAATCATATCTGTTTAATAAATTGGCTATAACTTTAATATCTGTGGAC-AACTTGTAAAATTTGGAATGTATCATATGTAAAAAGTTTAAAGATATCCAAATAAATGCTTTAGGTGTTGGCATTA
    4.92 +s spliceWithGap     4645 2476 -      7262 AGACGGGGAAATCCTTTACAGTTTATGCAAAGAGCGATTCAAGAAGATCTTGT--GAAG-TCTGGCACCAACACAGTGTCACAG--------GCCTGACATGCACAGGAAGCCAATCAGACACTGGTTGGCATTGACTGGCAACATTTATAATTATTGCACCACCAAAA--CACAAACTTGGATTTTA--AACCCAGTTGGCTTTT-AAGAAAGAAAGAAGTTCTGCTGAATTTGGAAATAAATTCTTTATTTAAACTTTCCTTCCCAGTTTTATAGTTTCTGGTTCTGAGGACTGATGAAAATCATCTTCCATCAGCAGATTTTCTTGCACTGTTTGCTGTGCCCCCTCAAATATAATGTCTTGGGTTTTAAGATCGAGCAAGGAGCTTCTCTTCCTAGATTGGATCCCAGCCCCTT-GTGGGG-TCTGACTGCATAGTCCCAGCCATTATGTGATATTTCACGTTATTGATGATAGTGAACTGTGGGTCCGAAGCTGACTCAACGGAGGCAGGGAACAAAGTCTCTGTGGTCTGTTGGGTCATACTTCCTGGTTCCACTGAGTGGCCCAACACTGGGACTGGGTTGGTGTCCCCTCTGCTGACAGGACCCTACTCCTAGGAGCAAAGTGGTTGATTTTGAAGGCAGTGTTCCCTTCTCTCCATTGACTATGAGAGAGTTGGGGGACACACATGCAGAAGAAGCCCGTGGG-AGAAGGTGGATTCCCTGGTGTGTTAAGGTTTCTTTTTCAGGGCTGTTAGAGGTttttttctttttttttttttttttttATGGCAAGACTTTTGGCTTTTGAGAAACCTCACTTAGAGGGCTTTCC-AAAACTTAGGATGGTCTAAAaaaattat--tattcttttTAGAATTA-GAAG-aaaattaggatattctaaaagaatATGGATTAAaaatttaggatattc-tTTAGATATCCTAATATTCAGATGAGAGGCC-TCCTTCATAAGATCTGGTTGTTTGGGCTGTGGTTGGCATAAGTGATATTTATTCTGGCCTCTGTCACATCCAGTTTCTCTGAGCTTTTAAGGT--GCTTCTTTTGGCTTTTTTTCAGATGTTCACT--GCTTAAGTTTAAAATAATAGGTATTCTAAAAAGCAGCATCCTAATTTTCTTATCTTCATTC-TTTAGAATACCCTTAATGTTCTCAGACAGTGATAT--TCTTGTTATTTCTAAGGCTAAATTGGCAGAGTATATCATCTAAAGCCAAACACTGAAGAAGGTGAGAACCCATCTCCCACCCAGCCAGCATTTCCTGGAACAGACAAGCTGCTGCTTCCTTGCTGGCTCACTTAGTGCATTCCTGGGATGGTCTGGCACCCAGCGGTTTTTTATTC-TTTTGATCATTGTTCTTACTGAGGTGCCTTCCTAGAACAAGAGCCACTCAAGCAAAATAGCTTATAATTATTATGTACCACAC----ACTATTGTTTGATGTATGACTGCTGAGAGCTTGAATACATGCAGAGAGTGACTGAAGACATAGTTAAGAGGAATAAATTTTGAGCCCGTCTAAGGTGGGGCTAAGGAACAGATGAGTAATAAGAGGTGCTCTT-GA---TCTTAACCAATGCAACTGACCCTTTCAATCAGTTTTCTTTTGAATTTACATCTACAAGTTTTGTTCCACTCAGCTACCAGTCAACTAGGCATGCCCTTGGT---CAGTATCACAGGAAGAAGGTCAGGAATCT-GAACTGAAGCTAAAAGAAGTGAGGATGTAGAAGCCACATTCCTTCTTCAAGGTAGTGTGTGAAAGAACTGCCCCCTCTTGACAGGAGGATGACTGTCGCCATTCTGGTGTGGGACTGACTCACCCAGCTGGAGAGGAGGACCAATAGAAAGAAAATTCACATTTGAGTCCAC--CTCTCCCCCTTTTTCTGGCCTTCATTCATAAGATCTGGTTGTTTGGGCTGTAGGTGGTACAATTCATGTTTA-TTTGGCCCCTGT--CATCCTTACAGTTTCTTTAGCTTTTAAGGTAAGCTTCTTTTGGC-TTTTTTCATATGTTCACCAAGCTAAAATTTAAAATAATAAGACCAGGTTTCTCTCTCTGTACAAAG-GGATTATAAACATTTTTCACCAAATCATAACAATACTCCAGCTTTCCGGTCCGACTTCCTAGGAGCCTGGGGTTAGCAAAGGTTGTCTTCT-GATTTCATTCTCTGAGAATATCACAGAGCCTGGGAGAAGATGAATTTACATGAAATTGCAACATACACACCTTTTTATTTTCTGGTGTTAAGCTAGTTGTCTTTCCTACCTTACAAATCATGTTAGCCTTATGATTTGTTCCGCATGTTTTATGTTTGCTGTAGAAATGTTTCTATATAATATACGCTTTCCATATCAGGGAAAAATCATATCTGTTTAATAAATTGGCTATAACTTTAATATCTGTGGACAAACTTGTAAAATTT-GAATGTATCATATGTAAAAAGTTTAAAGATATCCAAATAAATGCTTTAGGTGTTGGCATTA
    4.93 +
    4.94 +a score=1135 EG2=2e-92 E=8.3e-97
    4.95 +s chr6          42659653 202 + 170805979 AGCCCTGTGGCTTCAGATATGACACTTACAGCACTGGGCCCC-GCACAAACTCAGGTTCCTGAACAAAGACAATTCGTTACATGTATATTGTGTCAAGAGGAGCAAGAAGTTAAAGTGGAAAGCAGGGCAATGGTCTTGGCAGCATTTGTTCAGAGATCAACTGTATTATC-AAAAAACAGAAGTAAATTTATTCAAGATCCAG
    4.96 +s spliceWithGap     2758 204 -      7262 AGCCCTGTGGCTTCAGATATGACACTTACAGCACTGGGCCCCCACACAAACTCAGGTTCCTGAACAAAGACAATTCGTTACATGTATATTGTGTCAAGAGGAGCAAGAAGTTAAAGTGGAAAGCAGGGCAATGGTCTTGGCAGCATTTGTTCAGAGATCAACCGTATTATCAAAAAAACAGAAGTAAATTTATTCAAGATCCAG
    4.97 +
    4.98 +a score=946 EG2=3.2e-74 E=1.3e-78
    4.99 +s chr6          42688215 167 + 170805979 GTGCCCGAAATCAGGTGGTGATAAGAGCAGAGCCCCAACTCTGTGCCTTGTGTGCGGATCTCTGCTGTGCTCCCAGAGTTACTGCTGCCAGACTGAACTGGAAGGGGAGGATGTAGGAGCCTGCACAGCTCACACCTACTCCTGTGGCTCTGGAGTGGGCATCTTCC
   4.100 +s spliceWithGap     4372 166 -      7262 GTGCCCGAAATCAGGTGGTGATAAGAGCAGAGCCCCAATCCTGTGCCTTGTGTGCGGATCTCTGCTGTGC-CCCAGAGTTACTGCTGCCAGACTGAACTGGAAGGGGAGGATGTAGGAGCCTGCACAGCTCACACCTACTCCTGTGGCTCTGGAGTGGGCATCTTCC
   4.101 +
   4.102 +a score=842 EG2=3.3e-64 E=1.4e-68
   4.103 +s chr6          42663253 166 + 170805979 AAAGGTATTTTGATTCCGTTCAAGCTAAAGAACA--GCGAAGGCAACA-GAGATTACGCTTACATACGAGCTATGATGTAGAAAACGGAGAATTCCTTTGCCCCCTTTGTGAATGCTTGAGTAATA---CTGTTATTCCTCTGCTGCTTCCTCCAAGAAATATTTTTAACAA
   4.104 +s spliceWithGap     3050 170 -      7262 AAAGGTATTTTGATTCCGTTCAAGCTAAAGAACAAAGTGAAGGCAACAGGAGATTACGCTTACATACGAGCTATGATGTAGAAAACGGAGAATTCCTTTGCCCCCTTTGTGAATGCTTGAGCAA--GGCCTGTTATTCCTCTGTTGCTTCCTCCAAGAAATATTTTTAACAA
   4.105 +
   4.106 +a score=813 EG2=2e-61 E=8.4e-66
   4.107 +s chr6          42670097 143 + 170805979 TTATTCTGAGAGCATAAAAGAAATGCTAACGACATTTGGAACTGCTACCTACAAGGTGGGACTAAAGGTTCATCCCAATGAAGAGGATCCTCGTGTTCCCATAATGTGTTGGGGTAGCTGCGCGTACACCATCCAAAGC-ATAG
   4.108 +s spliceWithGap     3406 143 -      7262 TTATTCTGAGAGCATAAAAGAAATGCTAACGACATTT-GAACTGCTACCTACAAGGTGGGACTAAAGGTTCATCCCAATGAAGAGGATCCTCGTGTTCCCATAATGTGTTGGGGTAGCTGCGCGTACACCATCCAAAGCGATAG
   4.109 +
   4.110 +a score=780 EG2=3e-58 E=1.3e-62
   4.111 +s chr6          42632555 163 + 170805979 GAATGCTCATCACAGAAGAAAACTTAATGAGCATTATCATTAAGACTTTTATGGATCATTTGAG-ACATC-GAGATGCCCAGGGCAGATTTCAGTTTGAACGATACACTGCTTTACAAGCCTTCAAATTTAGGAGAGTACAGAGCCT-TATTTTAGATC---TCAAGTA
   4.112 +s spliceWithGap      681 166 -      7262 GAATGCTCATCACAGAAGAAA-CTTGATGAGCATTATCATTAAGACTTTTATGGATCATTTGAGGACATCTGAGATGCCCAGGGCAGATTTCAGTTTGAACGATACACTGCTTTACAAGCCTTCAA-CTTA-GAGAGTACAGAGCCTCTATTTTAGATCCTTTCAAGTA
   4.113 +
   4.114 +a score=733 EG2=1e-53 E=4.2e-58
   4.115 +s chr6          42678536 133 + 170805979 AGTGCCTTGAAAGAAATACCATCCGGCTGGCATCTGTGGAGGAGTGTCAGAGCTGGAATCATGCCTTTCCTG-AAGTGTTCTGCTTTATTTTTTCATTACTTAAATGGAGTTCCTTCCCCACCCGACATTCAAG
   4.116 +s spliceWithGap     3995 131 -      7262 AGTGCCTTGAAAGAAATACCATCCGGCTGGCATCTGTGGAGGAGTGTCAGAGCTGGAATCATGCCTTTCCTGGAAGTGTTCTGCTTTATTTTTTCATTACTTAAATGGAGTTCCTT---CACCCGACATTCAAG
   4.117 +
   4.118 +a score=707 EG2=3.2e-51 E=1.3e-55
   4.119 +s chr6          42676054 137 + 170805979 GGTGGGCTTGGTGCTTGCATT-TC-CTGCGTTGCAG------TGTCAGGATTTTTCAGGGATCAGCCTTGGCACTGGAGACCTTCACATTTTCCATCTGGTTACTATGGCACACATCATACAGATCTTACTTACCTCATGTACAG
   4.120 +s spliceWithGap     3764 143 -      7262 GGTGGGCTTGGTGCTTGCATTCTCTCTGCGTTGCAGCAAGTTTGT--GGATTTTTCAGGGATCAGCCTTGGCACTGGAGACCTTCACATTTTCCATCTGGTTACTATGGCACACATCATACAGATCTTACTTACCTCATGTACAG
   4.121 +
   4.122 +a score=688 EG2=2.2e-49 E=9.1e-54
   4.123 +s chr6          42605721 139 + 170805979 gagaagaGTGACACCTACT----ATTGCATGCTGTTTAATGATGAGGTTCACACCTATGAACAAGTTATTTATACTCTT-CAGAAAGCTGTTAACTGTACAC--AAAAAG-AAGCTATTGGTTTTGCAACTACAGTAGATCGAGATG
   4.124 +s spliceWithGap       57 145 -      7262 GAGAAGAGTGACACCTACTCATTATTGCATGC-G-TTAATGATGAGGTTCACACCTATGAACAAGTTATTTATACTCTTTCAGAAAGCTGTTAACTGTACACAAAAAAAGAAAGCTATTGGTTTTGCAACTACAGTAGATCGAGATG
   4.125 +
   4.126 +a score=678 EG2=2e-48 E=8.4e-53
   4.127 +s chr6          42637030 165 + 170805979 TTACAAGAAATGTCTCGCTGTACTGATGCAG-----TGTCATGGTGGTTATACTGATG--GTGAACAGCCAATCACACTAAGCATTTGTGGACATTCAGTGGAAACTATCAGATACTGTGTTTCCCAAGAAAAAGTTAGCATTCACCTCCCAGTTTCTCGCTT---ACTTGCAGG
   4.128 +s spliceWithGap     1095 174 -      7262 TTACAAGAAATGTCTCGCTGTACTGATGCAAACTACT-TCATGGTGGCGAGACCCATGCAGTGAACAGCCAATCACACTAAGCATTTGTGGACATTCAGTGGAAACCATCAGATACTGTGTTTCCCAAGAAAAAGTTAGCATTCACCTCCCAGTTTCTGGCTTTTCATTTGCAGG
   4.129 +
   4.130 +a score=642 EG2=5.9e-45 E=2.4e-49
   4.131 +s chr6          42679721 111 + 170805979 AGTTCCTGGAACAAGCCATTTTGAACATTTATGTAGCTATCTTTCCCTACCAAACAACCTCATTTGCCTTTTTCAAGAAAA--TAGTGAGATAATGAATTCACTGATTGAAAG
   4.132 +s spliceWithGap     4124 113 -      7262 AGTTCCTGGAACAAGCCATTTTGAACATTTATGTAGCTATCTTTCCCTACCAAACAACCTCATTTGCCTTTTTCAAGAAAAAATAGTGAGATAATGAATTCACTGATTGAAAG
   4.133 +
   4.134 +a score=620 EG2=7.7e-43 E=3.2e-47
   4.135 +s chr6          42635415 132 + 170805979 AGGGAATGGATCCAATTACACGTCAAGTAGGAC-AACATATTGAAATGGAACCAGAGTGGGAAGCAGCCTTC--ACACTACAAATGAAATTAACACATGTCA--TTTCAATGATGCAGGACTGGTGTGCTTCAGATG
   4.136 +s spliceWithGap      937 134 -      7262 AGGGAAGGGACCCAATTACACGTCA--TAG-ACAAACATATTGAAATGGAACCAGAGTGGGAAGCAGCCTTCTCACACTACAAATGAAATTAACACATGTCATTTTTCAATGATGCAGGACTGGTGTGCTTCAGATG
   4.137 +
   4.138 +a score=565 EG2=1.5e-37 E=6.4e-42
   4.139 +s chr6          42662180 100 + 170805979 CAGAAAAATATGATCCATTATTCATGCACCCTGATCTGTCTTGTGGAACACACACTAGTAGCTGTGGGCACATTATGCATGCCCATTGTTGGCAAAGGTA
   4.140 +s spliceWithGap     2959  98 -      7262 CAGAAAAATATGATCCATTATTCATGCACCCTGATCTGTCTTGTGGAACACAC--TAGTAGCTGTGGGCACATTATGCATGCCCATTGTTGGCAAAGGTA
   4.141 +
   4.142 +a score=551 EG2=3.4e-36 E=1.4e-40
   4.143 +s chr6          42615068 113 + 170805979 AGATGGCCTTCGCCGGATTTTATG-TCAAGTTGGTTTACAAGAAGGGCCAGATGGTGAAAACTCTTCTCTAGTGGACAGACTGATGCTTAGTGATTCCAAATTATGGAAAGGTG
   4.144 +s spliceWithGap      377 111 -      7262 AGATGGCCTTCGCCG-ATTTTATGCTCAAGTTGGTTTACAAGAAGGGCCAGATGGTG--AACTCTTCTCTAGTGGACAGACTGATGCTTAGTGATCTTAAATTATGGAAAGGTG
   4.145 +
   4.146 +a score=547 EG2=8.2e-36 E=3.4e-40
   4.147 +s chr6          42612169 122 + 170805979 GAGAAATACCAGTAGACAGACAAAGCCACTCAAAGTTCAAGTTATGCATTCGTCTATTGTCGCACATCAGAATTTTGGTTTGAAACTTTT--GTCTTGGCTGGGAAGTATTATTGGATATTCAG
   4.148 +s spliceWithGap      262 117 -      7262 GAGAAATACCAGTAGA--GACA--GCCACTTAAAGTTC--GCTATGCATTCGTCTATTGTCGCACATCAGAATTTTGGTTTGAAACTTTTTTGTCTTGGCTGGGAAGTATTATT-GATATTCAG
   4.149 +
   4.150 +a score=544 EG2=1.6e-35 E=6.7e-40
   4.151 +s chr6          42689566 104 + 170805979 AGAGTACGGGAATGTCAGGTGCTATTT-TTAGCTGGCAAAACCAAAGGCTGTTTTTATTCTCCTCCTTACCTTGATGACTATGGGGAGACCGACCA-GGGACTCAG
   4.152 +s spliceWithGap     4541 106 -      7262 AGAGTACGGGAATGTCAGGTGCTGTTTCTTAGCTGGCAAAACCAAAGGCTGTTTTTATTCTCCTCCTTACCTTGATGACTATGGGGAGACCGACCGTGGGACTCAG
   4.153 +
   4.154 +a score=527 EG2=6.9e-34 E=2.9e-38
   4.155 +s chr6          42692915 151 + 170805979 GGCCTTCATTCATAAGATCTGGTTGTTTGGGCTGTAGG-TGGCATAATTCATGTTTATTTTGGCCTCTGTCACATCCAGTTTCTTT-AGCTTTTAAGGTAAGCTTCTTTTGGCTTTTTTTCATATGTTCACCAAGCTAAAATTTAAAATAATA
   4.156 +s spliceWithGap     5589 147 -      7262 GGCCTCC-TTCATAAGATCTGGTTGTTTGGGCTGT-GGTTGGCATAAGTGATATTTATTCTGGCCTCTGTCACATCCAGTTTCTCTGAGCTTTTAAGGT--GCTTCTTTTGGCTTTTTTTCAGATGTTCACT--GCTTAAGTTTAAAATAATA
   4.157 +
   4.158 +a score=511 EG2=2.4e-32 E=1e-36
   4.159 +s chr6          42665408 96 + 170805979 CAGGTTAAATTTTTCAGACCAACCAAATCTGA-CTCAGTGGATTAGAACAATATCTCAGCAAATAAAAGCATTACAGTTTCTTAGGAAAGAAGAAAG
   4.160 +s spliceWithGap     3221 96 -      7262 CAGGTTAAATTTTTCAGACCAACCAAATCTGGGCTCAGTGGATTAGAACAATATCTCAGCAAATAAAAGCATTACAGTTTCTTAG-AAAGAAGAAAG
   4.161 +
   4.162 +a score=492 EG2=1.6e-30 E=6.8e-35
   4.163 +s chr6          42684791 82 + 170805979 AGATATCCAAGAGAATCTAACAAATTAATAAACCTTCCAGAGGATTACAGCAGCCTCATTAATCAAGCATCCAATTTCTCGT
   4.164 +s spliceWithGap     4292 82 -      7262 agatatcCAAGAGAATCTAACAAATTAATAAACCTTCCAGAGGATTACAGCAGCCTCATTAATCAAGCATCCAATTTCTCGT
   4.165 +
   4.166 +a score=489 EG2=3.1e-30 E=1.3e-34
   4.167 +s chr6          42632799 106 + 170805979 TTCAGGTATGTGTTAATTAGCAAACCAACTGAATGGTCAGATGAGCTGAGGCAGAAGTTCCTAGAAGGGTTTGATGCCTTTTTGGAATTACTAAAATGTATGCAGG
   4.168 +s spliceWithGap      839 101 -      7262 TTCAAGTATGTGTTAATTAGCAAACCAACTGAATGGTCAGATGAGCTGAGGCAGAAGTTCCC-GAAGGGTTTGATGCC-TTTTGGAATTACT-AAATGTA--CAGG
   4.169 +
   4.170 +a score=456 EG2=4.7e-27 E=2e-31
   4.171 +s chr6          42615998 92 + 170805979 AAGGTGCTAGGAGTGTATATCATCAGTTGT--TCATGAGCAGTCTGCTTATGGATTTGAAATACAAGAAACTATTTGCTGTTCGATTTGCAAAA
   4.172 +s spliceWithGap      482 93 -      7262 AAGGTGCTAG-AGTGTATATCATCAGTTGCCCTCATGAGCAGTTTGTTTATGGATTTGAAATACAAGAAACTATTTGCTGTTCGATTTGCAAAA
   4.173 +
   4.174 +a score=444 EG2=6.8e-26 E=2.8e-30
   4.175 +s chr6          42673789 98 + 170805979 GGATGACTGTCTTAGGTCATTGACGAGATTT--GCCGCAGCACACTGGACAGTGGCATCAGTTTCAGTGGTGCAAGGACATTTTTGTAAACTTTTTGCAT
   4.176 +s spliceWithGap     3603 94 -      7262 GGATGACTGTCTTAGGTCATTGACGAGATTTTTGCCGCAGCAC--TGGACAG---CACCAGTTTCAGTGGTGCAAGGACATTTTTGTAAACTTTT-GCAT
   4.177 +
   4.178 +a score=438 EG2=2.6e-25 E=1.1e-29
   4.179 +s chr6          42674125 73 + 170805979 CACTGGTGCCTAATGACAGCCATGAGGAACTTCCATGCATATTAGATATTGACATGTTTCATTTATTGGTGGG
   4.180 +s spliceWithGap     3697 73 -      7262 CACTGGTGCCTAATGACAGCCATGAGGAACTTCCATGCATATTAGATATTGACATGTTTCATTTATTGGTGGG
   4.181 +
   4.182 +a score=437 EG2=3.2e-25 E=1.3e-29
   4.183 +s chr6          42666167 77 + 170805979 TAATGCCTCTACAAAGAATTCAGAAAATGTGGATGAATTACAGCTCCCTGAAGGGTTCAGGCCTGATTTTCGTCCTA
   4.184 +s spliceWithGap     3327 76 -      7262 TAATGCCTCTACAAAGAATTCAGAAAATGT-GATGAATTACAGCTCCCTGAAGGGTTCAGGCCTGATTTTCGTCCTA
   4.185 +
   4.186 +a score=415 EG2=4.2e-23 E=1.8e-27
   4.187 +s chr6          42676779 94 + 170805979 CAGAAGAGAATGGCATGGATCAAGAAAATCCCCCTTGTGAAGAAGAATCAGCAGTTCTTGCTTTGTATAAAACACTTCACCAGTATACGGGAAG
   4.188 +s spliceWithGap     3904 93 -      7262 CAGAAGAGAATGCCATGGATCAAGAAAAATCCCCTTGTGC-GAAGAATCAGCAGTTCTTGCTTTGTATAAAACACTTCACCAGTATACGGAAAG
   4.189 +
   4.190 +a score=366 EG2=2.2e-18 E=9.2e-23
   4.191 +s chr6          42683050 61 + 170805979 AAAGTTGGTGCCGTAACAGTGAAGTTAAAAGATATCTAGAAGGTGAAAGAGATGCTATAAG
   4.192 +s spliceWithGap     4233 61 -      7262 AAAGTTGGTGCCGTAACAGTGAAGTTAAAAGATATCTAGAAGGTGaaagagatgctataag
   4.193 +
   4.194 +a score=353 EG2=3.9e-17 E=1.6e-21
   4.195 +s chr6          42606588 63 + 170805979 GGGCGTAGGTCTGTTCGATATGGAGATTTTCAGTATTGTGAGCAAGCAAAATCAGTAATTGTG
   4.196 +s spliceWithGap      201 62 -      7262 GGGCGTAGGTCTGTTCGATAT-GAGATTTTCAGTATTGTGAGCAAGCAAAATCAGTAATTGTG
   4.197 +
   4.198 +a score=344 EG2=2.9e-16 E=1.2e-20
   4.199 +s chr6          42617408 102 + 170805979 AACTATGAGCGTTTGCAGAGTGATTATGTGA---CAGATGACCACGACAGAGAGTTTTCAGTCGCAGACCTCTCGGTTCAGATA--TTCAC-GGTTCCTTCACTTGTA
   4.200 +s spliceWithGap      576 103 -      7262 AACTATGAGCGTTTGCAGAGTGATTACGTGATGTCAGATGACCACGACAGAG----TTAAAT-GCAGACCTCTCGGTCCAGATGGTTCCACAGGTTCCTTCACTTGTA
   4.201 +
   4.202 +a score=342 EG2=4.5e-16 E=1.9e-20
   4.203 +s chr6          42658730 94 + 170805979 CTGAAATGCA-GCGGCATTTTA--TTGA---TGAAAACAAAGAACTCTTTCAGCAGACATTAGAACTGGATGCCTCAACCTCTGCTGTTCTTGATCATAG
   4.204 +s spliceWithGap     2662 98 -      7262 CTGAAATGCATGCAG-ATTTGAGTTTGAGGCTGAAAACAGTGAACT-TTTCAGCAGACATTAGAACTGGATGCCTCAACCTCTGCTGTTCTTGATCATAG
   4.205 +
   4.206 +a score=335 EG2=2.1e-15 E=8.9e-20
   4.207 +s chr6          42670656 60 + 170805979 TAGAAAGAATTTTGAGTGATGAAGATAAACCATTGTTTGGTCCTTTACCTTGCAGACTGG
   4.208 +s spliceWithGap     3546 59 -      7262 TAGAAAGAATTTTGAGTGATGAAGATAAACCATTGTTTG-TCCTTTACCTTGCAGACTGG
   4.209 +
   4.210 +a score=229 EG2=3.4e-05 E=1.4e-09
   4.211 +s chr2          214812952 46 + 242193529 aaaaaaaaaaaaaaaaaaaacacaaaaggaaaagaaagaaaaagaa
   4.212 +s spliceWithGap      7120 45 -      7262 Aaaaaaaaaaaaaaaaaaaacacaaaaggaaaa-aaaaaaaaagAA
   4.213 +
   4.214 +a score=208 EG2=0.0036 E=1.5e-07
   4.215 +s chr6          42640198 42 + 170805979 tttcat--GCA-GGTTTACATGTATTATTAAGCAAAAGTGAAGTG
   4.216 +s spliceWithGap     1256 45 -      7262 TTTCATTTGCAGGGTTTACATGTATTATTAAGCAAAAGTGAAGTG
   4.217 +
   4.218 +a score=180 EG2=1.8 E=7.5e-05
   4.219 +s chr10         13638294 30 + 133797422 ttttctttttttttttttttttttATGGCA
   4.220 +s spliceWithGap     5394 30 -      7262 ttttctttttttttttttttttttATGGCA
   4.221 +
   4.222 +a score=175 EG2=5.3 E=0.00023
   4.223 +s chr5          144727932 34 + 181538259 tttttttctttttttttttttttttttttggcaa
   4.224 +s spliceWithGap      5391 34 -      7262 TttttttctttttttttttttttttttATGGCAA
   4.225 +
   4.226 +a score=175 EG2=5.3 E=0.00023
   4.227 +s chr9          89531443 34 + 138394717 Aaaaaaaaaaaaaaaaaaacaccaaaggaaaaaa
   4.228 +s spliceWithGap     7121 34 -      7262 aaaaaaaaaaaaaaaaaaacacaaaaggaaaaaa
   4.229 +
   4.230 +a score=174 EG2=6.7 E=0.00028
   4.231 +s chr2          182431117 29 + 242193529 cattaaaaaaaaaaaaaaaaaaaacacaa
   4.232 +s spliceWithGap      7116 29 -      7262 CATTAaaaaaaaaaaaaaaaaaaacacaa
   4.233 +
   4.234 +a score=172 EG2=10 E=0.00044
   4.235 +s chr11         132048811 32 + 135086622 ttttttctttttttttttttttttttaTAGCA
   4.236 +s spliceWithGap      5392 32 -      7262 ttttttctttttttttttttttttttATGGCA
   4.237 +
   4.238 +a score=170 EG2=16 E=0.00069
   4.239 +s chr22         36880353 32 + 50818468 aaaaaaaaaaaaaaaaacacaagaggaaaaaa
   4.240 +s spliceWithGap     7123 32 -     7262 aaaaaaaaaaaaaaaaacacaaaaggaaaaaa
   4.241 +
   4.242 +a score=170 EG2=16 E=0.00069
   4.243 +s chr8          69767889 40 + 145138636 AAAAAAaaaaaaaaaaaaaaaacaaaaagaaaaagaaaaa
   4.244 +s spliceWithGap     7120 40 -      7262 Aaaaaaaaaaaaaaaaaaaacacaaaaggaaaaaaaaaaa
   4.245 +
   4.246 +a score=169 EG2=20 E=0.00086
   4.247 +s chr12         42640460 33 + 133275309 Aaaaaaaaaaaaaaaaaacagaaaaggaaaaaa
   4.248 +s spliceWithGap     7122 33 -      7262 aaaaaaaaaaaaaaaaaacacaaaaggaaaaaa
   4.249 +
   4.250 +a score=169 EG2=20 E=0.00086
   4.251 +s chr3          89854073 34 + 198295559 agaggtttttttctttttttttttttttcctttt
   4.252 +s spliceWithGap     5386 32 -      7262 AGAGGTttttttcttttttttttttttt--tttt
   4.253 +
   4.254 +a score=166 EG2=39 E=0.0017
   4.255 +s chr9          94409129 35 + 138394717 tttttttttttttttttttttttttttaaGGCAAG
   4.256 +s spliceWithGap     5391 35 -      7262 TttttttctttttttttttttttttttATGGCAAG
   4.257 +
   4.258 +a score=162 EG2=95 E=0.004
   4.259 +s chr7          29009180 27 + 159345973 TGGCATTAaaaaaaaaaaaaaaaaaaa
   4.260 +s spliceWithGap     7113 27 -      7262 TGGCATTAaaaaaaaaaaaaaaaaaaa
   4.261 +
   4.262 +a score=160 EG2=1.5e+02 E=0.0063
   4.263 +s chr6          89978622 41 + 170805979 GTGTTGGCTttaaaaaaaaaaaaaaaaaaaa---aaaaGCaaaa
   4.264 +s spliceWithGap     7109 44 -      7262 GTGTTGGCATTAaaaaaaaaaaaaaaaaaaacacaaaaggaaaa
   4.265 +
   4.266 +# Query sequences=1