Python3-ify: dotplot, train, convert, swap
authorMartin C. Frith
Mon May 28 14:53:43 2018 +0900 (2018-05-28)
changeset 941f3f1ec72542f
parent 940 05d2563d02e0
child 942 82b69208c878
Python3-ify: dotplot, train, convert, swap
scripts/last-dotplot
scripts/last-train
scripts/maf-convert
scripts/maf-swap
test/last-test.sh
test/maf-swap-test.out
test/maf-swap-test.sh
     1.1 --- a/scripts/last-dotplot	Mon May 28 14:25:13 2018 +0900
     1.2 +++ b/scripts/last-dotplot	Mon May 28 14:53:43 2018 +0900
     1.3 @@ -239,12 +239,12 @@
     1.4      yield oldBeg, maxEnd
     1.5  
     1.6  def mergedRangesPerSeq(coverDict):
     1.7 -    for k, v in coverDict.iteritems():
     1.8 +    for k, v in coverDict.items():
     1.9          v.sort()
    1.10          yield k, list(mergedRanges(v))
    1.11  
    1.12  def coveredLength(mergedCoverDict):
    1.13 -    return sum(sum(e - b for b, e in v) for v in mergedCoverDict.itervalues())
    1.14 +    return sum(sum(e - b for b, e in v) for v in mergedCoverDict.values())
    1.15  
    1.16  def trimmed(seqRanges, coverDict, minAlignedBases, maxGapFrac, endPad, midPad):
    1.17      maxEndGapFrac, maxMidGapFrac = twoValuesFromOption(maxGapFrac, ",")
     2.1 --- a/scripts/last-train	Mon May 28 14:25:13 2018 +0900
     2.2 +++ b/scripts/last-train	Mon May 28 14:53:43 2018 +0900
     2.3 @@ -382,10 +382,12 @@
     2.4      x += args
     2.5      y = ["last-split", "-n"]
     2.6      z = ["last-postmask"]
     2.7 -    p = subprocess.Popen(x, stdout=subprocess.PIPE)
     2.8 -    q = subprocess.Popen(y, stdin=p.stdout, stdout=subprocess.PIPE)
     2.9 +    p = subprocess.Popen(x, stdout=subprocess.PIPE, universal_newlines=True)
    2.10 +    q = subprocess.Popen(y, stdin=p.stdout, stdout=subprocess.PIPE,
    2.11 +                         universal_newlines=True)
    2.12      if opts.postmask:
    2.13 -        q = subprocess.Popen(z, stdin=q.stdout, stdout=subprocess.PIPE)
    2.14 +        q = subprocess.Popen(z, stdin=q.stdout, stdout=subprocess.PIPE,
    2.15 +                             universal_newlines=True)
    2.16      lastalVersion = versionFromHeader(q.stdout)
    2.17      externalScale = scaleFromHeader(q.stdout)
    2.18      internalScale = externalScale * scaleIncrease
    2.19 @@ -425,14 +427,17 @@
    2.20          x = fixedLastalArgs(opts, lastalProgName)
    2.21          x.append("-p-")
    2.22          x += args
    2.23 -        p = subprocess.Popen(x, stdin=subprocess.PIPE, stdout=subprocess.PIPE)
    2.24 +        p = subprocess.Popen(x, stdin=subprocess.PIPE, stdout=subprocess.PIPE,
    2.25 +                             universal_newlines=True)
    2.26          writeGapCosts(gapCosts, p.stdin)
    2.27          writeMatrixWithLetters(p.stdin, internalMatrix, "")
    2.28          p.stdin.close()
    2.29          # in python2.6, the next line must come after p.stdin.close()
    2.30 -        q = subprocess.Popen(y, stdin=p.stdout, stdout=subprocess.PIPE)
    2.31 +        q = subprocess.Popen(y, stdin=p.stdout, stdout=subprocess.PIPE,
    2.32 +                             universal_newlines=True)
    2.33          if opts.postmask:
    2.34 -            q = subprocess.Popen(z, stdin=q.stdout, stdout=subprocess.PIPE)
    2.35 +            q = subprocess.Popen(z, stdin=q.stdout, stdout=subprocess.PIPE,
    2.36 +                                 universal_newlines=True)
    2.37  
    2.38      gapCosts = gapCostsFromProbs(externalScale, gapProbs)
    2.39      writeGapCosts(gapCosts, sys.stdout)
    2.40 @@ -451,7 +456,7 @@
    2.41          refName = args[0]
    2.42          queryFiles = args[1:]
    2.43          try:
    2.44 -            with tempfile.NamedTemporaryFile(delete=False) as f:
    2.45 +            with tempfile.NamedTemporaryFile("w", delete=False) as f:
    2.46                  getSeqSample(opts, queryFiles, f)
    2.47              doTraining(opts, [refName, f.name])
    2.48          finally:
     3.1 --- a/scripts/maf-convert	Mon May 28 14:25:13 2018 +0900
     3.2 +++ b/scripts/maf-convert	Mon May 28 14:53:43 2018 +0900
     3.3 @@ -12,6 +12,11 @@
     3.4  import gzip
     3.5  import math, optparse, os, signal, sys
     3.6  
     3.7 +try:
     3.8 +    from future_builtins import map, zip
     3.9 +except ImportError:
    3.10 +    pass
    3.11 +
    3.12  def myOpen(fileName):
    3.13      if fileName == "-":
    3.14          return sys.stdin
    3.15 @@ -40,7 +45,7 @@
    3.16      return sum(k == "-" for k, v in groupby(row))
    3.17  
    3.18  def alignmentRowsFromColumns(columns):
    3.19 -    return imap(''.join, izip(*columns))
    3.20 +    return map(''.join, zip(*columns))
    3.21  
    3.22  def symbolSize(symbol, letterSize):
    3.23      if symbol == "\\": return 1
    3.24 @@ -210,7 +215,7 @@
    3.25  
    3.26      letterSizes = [i[3] for i in sLines]
    3.27      rows = [i[6] for i in sLines]
    3.28 -    alignmentColumns = izip(*rows)
    3.29 +    alignmentColumns = zip(*rows)
    3.30      gapWord = ",".join(matchAndInsertSizes(alignmentColumns, letterSizes))
    3.31      outWords.append(gapWord)
    3.32  
    3.33 @@ -242,7 +247,7 @@
    3.34  
    3.35      letterSizes = [i[3] for i in sLines]
    3.36      rows = [i[6] for i in sLines]
    3.37 -    alignmentColumns = izip(*rows)
    3.38 +    alignmentColumns = zip(*rows)
    3.39      size = "0"
    3.40      for i in matchAndInsertSizes(alignmentColumns, letterSizes):
    3.41          if ":" in i:
    3.42 @@ -272,7 +277,7 @@
    3.43          letterSizeB, begB, endB, rowB = fieldsB[3:7]
    3.44  
    3.45          size = 0
    3.46 -        for x, y in izip(rowA.upper(), rowB.upper()):
    3.47 +        for x, y in zip(rowA.upper(), rowB.upper()):
    3.48              if x == "-":
    3.49                  if size:
    3.50                      yield size, begA, begB
    3.51 @@ -502,18 +507,18 @@
    3.52  
    3.53      pos = str(begA + 1)  # convert to 1-based coordinate
    3.54  
    3.55 -    alignmentColumns = zip(rowA.upper(), rowB.upper())
    3.56 +    alignmentColumns = list(zip(rowA.upper(), rowB.upper()))
    3.57  
    3.58      revBegB = seqLenB - endB
    3.59      cigar = "".join(cigarParts(begB, iter(alignmentColumns), revBegB))
    3.60  
    3.61 -    seq = rowB.translate(None, "-")
    3.62 +    seq = rowB.replace("-", "")
    3.63  
    3.64      qual = "*"
    3.65      if qLines:
    3.66          qFields = qLines[-1].split()
    3.67          if qFields[1] == seqNameB:
    3.68 -            qual = ''.join(j for i, j in izip(rowB, qFields[2]) if i != "-")
    3.69 +            qual = ''.join(j for i, j in zip(rowB, qFields[2]) if i != "-")
    3.70  
    3.71      # It's hard to get all the pair info, so this is very
    3.72      # incomplete, but hopefully good enough.
    3.73 @@ -588,9 +593,9 @@
    3.74      coords = [i[4] for i in sLines]
    3.75      for chunkCols in chunker(alignmentColumns, lineSize):
    3.76          chunkRows = list(alignmentRowsFromColumns(chunkCols))
    3.77 -        begs = map(blastBegCoordinate, coords, strands, seqLens)
    3.78 -        coords = map(nextCoordinate, coords, chunkRows, letterSizes)
    3.79 -        ends = map(blastEndCoordinate, coords, strands, seqLens)
    3.80 +        begs = list(map(blastBegCoordinate, coords, strands, seqLens))
    3.81 +        coords = list(map(nextCoordinate, coords, chunkRows, letterSizes))
    3.82 +        ends = list(map(blastEndCoordinate, coords, strands, seqLens))
    3.83          yield chunkCols, chunkRows, begs, ends
    3.84  
    3.85  def writeBlast(opts, maf, oldQueryName):
    3.86 @@ -621,7 +626,7 @@
    3.87  
    3.88      print(scoreLine)
    3.89  
    3.90 -    alignmentColumns = zip(rowA, rowB)
    3.91 +    alignmentColumns = list(zip(rowA, rowB))
    3.92  
    3.93      alnSize = len(alignmentColumns)
    3.94      matches = sum(x.upper() == y.upper() for x, y in alignmentColumns)
    3.95 @@ -667,7 +672,7 @@
    3.96      seqNameA, begA, endA, rowA = blastDataFromMafFields(fieldsA)
    3.97      seqNameB, begB, endB, rowB = blastDataFromMafFields(fieldsB)
    3.98  
    3.99 -    alignmentColumns = zip(rowA, rowB)
   3.100 +    alignmentColumns = list(zip(rowA, rowB))
   3.101      alnSize = len(alignmentColumns)
   3.102      matches = sum(x == y for x, y in alignmentColumns)
   3.103      matchPercent = "%.2f" % (100.0 * matches / alnSize)
   3.104 @@ -762,15 +767,15 @@
   3.105  
   3.106      if pLines:
   3.107          probRows = [i.split()[1] for i in pLines]
   3.108 -        probCols = izip(*probRows)
   3.109 -        classes = imap(probabilityClass, probCols)
   3.110 +        probCols = zip(*probRows)
   3.111 +        classes = map(probabilityClass, probCols)
   3.112      else:
   3.113          classes = repeat(None)
   3.114  
   3.115      seqNames = [i[0] for i in sLines]
   3.116      nameWidth = maxlen(seqNames)
   3.117      rows = [i[6] for i in sLines]
   3.118 -    alignmentColumns = zip(*rows)
   3.119 +    alignmentColumns = list(zip(*rows))
   3.120  
   3.121      print('<pre>')
   3.122      for chunk in blastChunker(sLines, opts.linesize, alignmentColumns):
     4.1 --- a/scripts/maf-swap	Mon May 28 14:25:13 2018 +0900
     4.2 +++ b/scripts/maf-swap	Mon May 28 14:53:43 2018 +0900
     4.3 @@ -7,24 +7,30 @@
     4.4  # flip all the strands.  But don't do this if the top sequence is
     4.5  # translated DNA.
     4.6  
     4.7 -# Seems to work with Python 2.x, x>=4
     4.8 -
     4.9  from __future__ import print_function
    4.10  
    4.11 -import fileinput, itertools, optparse, os, signal, string, sys
    4.12 +import gzip
    4.13 +import itertools
    4.14 +import optparse
    4.15 +import os
    4.16 +import signal
    4.17 +import sys
    4.18  
    4.19 -def filterComments(lines):
    4.20 -    for i in lines:
    4.21 -        if i.startswith("#"): print(i, end="")
    4.22 -        else: yield i
    4.23 +try:
    4.24 +    maketrans = str.maketrans
    4.25 +except AttributeError:
    4.26 +    from string import maketrans
    4.27  
    4.28 -def mafInput(lines):
    4.29 -    for k, v in itertools.groupby(lines, str.isspace):
    4.30 -        if not k: yield list(v)
    4.31 +def myOpen(fileName):
    4.32 +    if fileName == "-":
    4.33 +        return sys.stdin
    4.34 +    if fileName.endswith(".gz"):
    4.35 +        return gzip.open(fileName)
    4.36 +    return open(fileName)
    4.37  
    4.38  def indexOfNthSequence(mafLines, n):
    4.39      for i, line in enumerate(mafLines):
    4.40 -        if line.startswith("s"):
    4.41 +        if line[0] == "s":
    4.42              if n == 1: return i
    4.43              n -= 1
    4.44      raise Exception("encountered an alignment with too few sequences")
    4.45 @@ -35,72 +41,57 @@
    4.46      stop = start + 1
    4.47      while stop < len(mafLines):
    4.48          line = mafLines[stop]
    4.49 -        if not (line.startswith("q") or line.startswith("i")): break
    4.50 +        if line[0] not in "qi": break
    4.51          stop += 1
    4.52      return start, stop
    4.53  
    4.54 -complement = string.maketrans('ACGTNSWRYKMBDHVacgtnswrykmbdhv',
    4.55 -                              'TGCANSWYRMKVHDBtgcanswyrmkvhdb')
    4.56 +complement = maketrans('ACGTNSWRYKMBDHVacgtnswrykmbdhv',
    4.57 +                       'TGCANSWYRMKVHDBtgcanswyrmkvhdb')
    4.58  # doesn't handle "U" in RNA sequences
    4.59  def revcomp(seq):
    4.60      return seq[::-1].translate(complement)
    4.61  
    4.62 -def flippedMafS(words):
    4.63 -    alnStart = int(words[2])
    4.64 -    alnSize = int(words[3])
    4.65 -    strand = words[4]
    4.66 -    seqSize = int(words[5])
    4.67 -    alnString = words[6]
    4.68 -    newStart = seqSize - alnStart - alnSize
    4.69 -    if strand == "-": newStrand = "+"
    4.70 -    else:             newStrand = "-"
    4.71 -    newString = revcomp(alnString)
    4.72 -    out = words[0], words[1], newStart, alnSize, newStrand, seqSize, newString
    4.73 -    return map(str, out)
    4.74 -
    4.75 -def flippedMafP(words):
    4.76 -    flippedString = words[1][::-1]
    4.77 -    return words[:1] + [flippedString]
    4.78 -
    4.79 -def flippedMafQ(words):
    4.80 -    qualityString = words[2]
    4.81 -    flippedString = qualityString[::-1]
    4.82 -    return words[:2] + [flippedString]
    4.83 -
    4.84 -def flippedMafLine(mafLine):
    4.85 -    words = mafLine.split()
    4.86 -    if   words[0] == "s": return flippedMafS(words)
    4.87 -    elif words[0] == "p": return flippedMafP(words)
    4.88 -    elif words[0] == "q": return flippedMafQ(words)
    4.89 -    else: return words
    4.90 -
    4.91 -def maxlen(s):
    4.92 -    return max(map(len, s))
    4.93 +def flippedMafRecords(mafLines):
    4.94 +    for line in mafLines:
    4.95 +        words = line.split()
    4.96 +        if words[0] == "s":
    4.97 +            s, name, start, span, strand, seqlen, alnString = words
    4.98 +            newStart = str(int(seqlen) - int(start) - int(span))
    4.99 +            newStrand = "+-"[strand == "+"]
   4.100 +            newString = revcomp(alnString)
   4.101 +            yield [s, name, newStart, span, newStrand, seqlen, newString]
   4.102 +        elif words[0] == "p":
   4.103 +            yield words[:1] + [words[1][::-1]]
   4.104 +        elif words[0] == "q":
   4.105 +            yield words[:2] + [words[2][::-1]]
   4.106 +        else:
   4.107 +            yield words
   4.108  
   4.109  def sLineFieldWidths(mafLines):
   4.110      sLines = (i for i in mafLines if i[0] == "s")
   4.111      sColumns = zip(*sLines)
   4.112 -    return map(maxlen, sColumns)
   4.113 +    for i in sColumns:
   4.114 +        yield max(map(len, i))
   4.115  
   4.116 -def joinedMafS(words, fieldWidths):
   4.117 -    formatParams = itertools.chain(*zip(fieldWidths, words))
   4.118 +def joinedMafS(fieldWidths, words):
   4.119 +    formatParams = itertools.chain.from_iterable(zip(fieldWidths, words))
   4.120      return "%*s %-*s %*s %*s %*s %*s %*s\n" % tuple(formatParams)
   4.121  
   4.122  def joinedMafLine(words, fieldWidths):
   4.123      if words[0] == "s":
   4.124 -        return joinedMafS(words, fieldWidths)
   4.125 +        return joinedMafS(fieldWidths, words)
   4.126      elif words[0] == "q":
   4.127          words = words[:2] + [""] * 4 + words[2:]
   4.128 -        return joinedMafS(words, fieldWidths)
   4.129 +        return joinedMafS(fieldWidths, words)
   4.130      elif words[0] == "p":
   4.131          words = words[:1] + [""] * 5 + words[1:]
   4.132 -        return joinedMafS(words, fieldWidths)
   4.133 +        return joinedMafS(fieldWidths, words)
   4.134      else:
   4.135          return " ".join(words) + "\n"
   4.136  
   4.137  def flippedMaf(mafLines):
   4.138 -    flippedLines = map(flippedMafLine, mafLines)
   4.139 -    fieldWidths = sLineFieldWidths(flippedLines)
   4.140 +    flippedLines = list(flippedMafRecords(mafLines))
   4.141 +    fieldWidths = list(sLineFieldWidths(flippedLines))
   4.142      return (joinedMafLine(i, fieldWidths) for i in flippedLines)
   4.143  
   4.144  def isCanonicalStrand(mafLine):
   4.145 @@ -114,15 +105,32 @@
   4.146      if len(alnString) - gapCount < alnSize: return True  # translated DNA
   4.147      return False
   4.148  
   4.149 +def swapOneMaf(opts, mafLines):
   4.150 +    start, stop = rangeOfNthSequence(mafLines, opts.n)
   4.151 +    mafLines[1:stop] = mafLines[start:stop] + mafLines[1:start]
   4.152 +    if not isCanonicalStrand(mafLines[1]):
   4.153 +        mafLines = flippedMaf(mafLines)
   4.154 +    for i in mafLines:
   4.155 +        print(i, end="")
   4.156 +    print()  # blank line after each alignment
   4.157 +
   4.158  def mafSwap(opts, args):
   4.159 -    inputLines = fileinput.input(args)
   4.160 -    for mafLines in mafInput(filterComments(inputLines)):
   4.161 -        start, stop = rangeOfNthSequence(mafLines, opts.n)
   4.162 -        mafLines[1:stop] = mafLines[start:stop] + mafLines[1:start]
   4.163 -        if not isCanonicalStrand(mafLines[1]):
   4.164 -            mafLines = flippedMaf(mafLines)
   4.165 -        for i in mafLines: print(i, end="")
   4.166 -        print()  # blank line after each alignment
   4.167 +    if not args:
   4.168 +        args = ["-"]
   4.169 +    for fileName in args:
   4.170 +        inputLines = myOpen(fileName)
   4.171 +        mafLines = []
   4.172 +        for line in inputLines:
   4.173 +            if line[0] == "#":
   4.174 +                print(line, end="")
   4.175 +            elif line.isspace():
   4.176 +                if mafLines:
   4.177 +                    swapOneMaf(opts, mafLines)
   4.178 +                    mafLines = []
   4.179 +            else:
   4.180 +                mafLines.append(line)
   4.181 +        if mafLines:
   4.182 +            swapOneMaf(opts, mafLines)
   4.183  
   4.184  if __name__ == "__main__":
   4.185      signal.signal(signal.SIGPIPE, signal.SIG_DFL)  # avoid silly error message
     5.1 --- a/test/last-test.sh	Mon May 28 14:25:13 2018 +0900
     5.2 +++ b/test/last-test.sh	Mon May 28 14:53:43 2018 +0900
     5.3 @@ -206,6 +206,7 @@
     5.4  ./last-split-test.sh
     5.5  ./last-train-test.sh
     5.6  ./maf-convert-test.sh
     5.7 +./maf-swap-test.sh
     5.8  
     5.9  # Test: lastdb, lastal, last-split, maf-sort, maf-join
    5.10  cd ../examples
     6.1 --- /dev/null	Thu Jan 01 00:00:00 1970 +0000
     6.2 +++ b/test/maf-swap-test.out	Mon May 28 14:53:43 2018 +0900
     6.3 @@ -0,0 +1,771 @@
     6.4 +TEST maf-swap -h
     6.5 +Usage: maf-swap [options] my-alignments.maf
     6.6 +
     6.7 +Change the order of sequences in MAF-format alignments.
     6.8 +
     6.9 +Options:
    6.10 +  -h, --help  show this help message and exit
    6.11 +  -n N        move the Nth sequence to the top (default: 2)
    6.12 +
    6.13 +TEST maf-swap bs100.maf
    6.14 +a score=429 mismap=8.07e-08
    6.15 +s 0       0 87 +    87 GGTTTAGGAGGAGTAGGGGTAGGTTTTGGCTCGTAAGAAGGTTTAGATAGGGGATTGTGCGGTGTGTGATGTTAGGGTAGAATTCGA
    6.16 +q 0                    B?ACCACCBCCCCCCACCACCBBCC@CABBCBCCCCBBBCBACBCBBBCCCCBBBCCB@BB?CBBB?CABC8CCCBC@@CC3<=A@C
    6.17 +s chrM 2571 87 - 16571 GGTCTAGGAGGAGTAGGGGCAGGTTTTGGCTCGTAAGAAGGCCTAGATAGGGGATTGTGCGGTGTGTGATGCTAGGGTAGAATCCGA
    6.18 +p                      &+.25;AGMSY^bcfgggfdfgfcbbceecbcedfgggggfcccfgfdgggggfccededffdededffdeccca\VPLGA;52.+&
    6.19 +
    6.20 +a score=420 mismap=8.17e-08
    6.21 +s 1       0 87 +    87 TTATATAGAGGAGATAAGTCGTAATATGGTAAGTGTATTGGAAAGTGTATTTGGATGAACTAGAGTGTAGTTTAATATAAAGCATTT
    6.22 +q 1                    BB@1;?@B@BBBC@BBBCACBBA>B??=?A@B?B?B=7@4BB;B>@@@A?>=B@A@>@7>BA>BA6BA?@@B@@?B?AABBAB=<>B
    6.23 +s chrM 1543 87 + 16571 TTATATAGAGGAGACAAGTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAACCAGAGTGTAGCTTAACACAAAGCACCC
    6.24 +p                      $(-16:@FLRW]bddfgfccedffdedffdfgfdedeccfggggfdedecbcfgfdfgfddfggfdedfecba`]WTOKF@:40+'$
    6.25 +
    6.26 +a score=207 mismap=1.15e-07
    6.27 +s 10      0 60 +    87 TTTTTTTTTTTAATCATATATTTATGGTTAATTTTTTATTTTTTATTGTATTTATTCTAA
    6.28 +q 10                   @6)>B+A9<)?>>A(?A=-(48/<5?=1>4>:B@@<-:@@5;/9==ABA47*5':B<###
    6.29 +s chrM 3290 60 + 16571 ttcctcttcttaacaacaTACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAA
    6.30 +p                      #&),/247:=AFIKLQTY\_`abedffccfecbaabbda`_][XVQNJEB=963/,(%$"
    6.31 +
    6.32 +a score=403 mismap=8.09e-08
    6.33 +s 11     0 87 +    87 GGTTGTTGATGGGTGAGTTAATATTTGGGTGGTATTTAAATTTGTTTTTTTATGAAAGAATAGAGAATAGTTTAAATTAGAATTTTA
    6.34 +q 11                  9<CCCA>BBC@4ABC:?CCC=ACCCABABC@BCCC9?=>A<7BC==;6AB@8BA<4?B?'?8<B@6/3B924>BA9(?B=6.?A@>3
    6.35 +s chrM 487 87 - 16571 GGTTGTTGATGGGTGAGTCAATACTTGGGTGGTACCCAAATCTGCTTCCCCATGAAAGAACAGAGAATAGTTTAAATTAGAATCTTA
    6.36 +p                     &+.27:>DIMSY^`dffccffdecbcfgfdffdecbcfgfcbcdbbaaabbedfgggggfdfggggfdfeba`_[UPLID?93/,(%
    6.37 +
    6.38 +a score=366 mismap=8.4e-08
    6.39 +s 12      0 87 +    87 TCGTATAAAATTTAAAATTTTATAGTTAGAGGTTTAATTTTTTTTTTTAATAATATATTTATGGTTAATTTTTTATTTTTTATTGTA
    6.40 +q 12                   <BCCCCCCCCCC=CCCCCCCCCCC?BCCCCC??>CBCCCCCCCCBCCCCBCCCCCCC@@ACACCBC@CBCBC@?@A9CCCBCABCCB
    6.41 +s chrM 3253 87 + 16571 tcgcataaaacttaaaactttacagtcagaggttcaattcctcttcttaacaacaTACCCATGGCCAACCTCCTACTCCTCATTGTA
    6.42 +p                      $(-16:@FKPSVZ_dfecbbcedffccfgggfccceecbaaaaaaabcefdffdedecbcedffcceda_\ZWURMIFC@=:52.)&
    6.43 +
    6.44 +a score=375 mismap=8.34e-08
    6.45 +s 13       0 87 +    87 TAAGTATTTTATTTTTAGTTTATTGTTAAATTTATTTTCGATTTTTAAGTTTTATAAGGGTTATCGTAGTTTTTTGGGGTAGAAAAT
    6.46 +q 13                    B@BBAB?ACBA@@BAA>ABAB:>AA@9?@AA9=@BB;@>@A8><2?99A@;B@?@B889@?5:@?76:?=6588=568:999;8666
    6.47 +s chrM 15116 87 - 16571 TAAGCACTCTACTCTCAGTTTACTGCTAAATCCACCTTCGACCCTTAAGTTTCATAAGGGCTATCGTAGTTTTCTGGGGTAGAAAAT
    6.48 +p                       $*059>ADGKORUX[^bdcbcdcceccfgfcbcdbbbbceecbbbcfffcbbcedfgggfcceccedfecbaaa``\WQKGB<60*$
    6.49 +
    6.50 +a score=367 mismap=8.23e-08
    6.51 +s 14      0 86 +    87 AAATATTTTGACGTCGGTGTGGATAGTGATGATTATGGTAGCGGAGGTGAAATATGTTTGTGTGTTTACGTTTATTTTTATTGTAT
    6.52 +q 14                   8CCACCC<BBA5=CCCCCB><ACBC@C+BCBBBCC<@B9BBBC@CB=@BBB@BAABBB@A@AB=:BB?@@A16@?@);B:@<9?A#
    6.53 +s chrM 9704 86 - 16571 AAATACTTTGACGCCGGTGGGGATAGCGATGATTATGGTAGCGGAGGTGAAATATGCTCGTGTGTCTACGTCTATTCCTACTGTAA
    6.54 +p                      &,15:=@CGMRVZ\^`^YUPV\`befdffdffccedffdffdfggggdfggfdedecbcededecbbca_ZWTQLHEB?=841,(#
    6.55 +
    6.56 +a score=352 mismap=8.84e-08
    6.57 +s 15       1 86 +    87 TTATTTTTGTCTTAGTATGATTTATTTTATATTTTAATTTATGAGATTTATAATAAATAGTTTTTTTAAATGTTAATTTAAGTTTC
    6.58 +q 15                    @1>(?@)@C>(>CCC>)@1:15=>9@=ACCC@>A?*=B?8,>4@BCBCCACCB>))@/ABA=1>5>BB*A+B<<.>B=-==ABB78
    6.59 +s chrM 12881 86 + 16571 TCATCCTCGCCTTAGCATGATTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAACGCTAATCCAAGCCTC
    6.60 +p                       $',.147:?BDHLQVZ^`decbcdbbbcedecbbbdecbcedfggfcbcedffdeffdfecbaaabceeda_ZWSNIEB>:4.*'$
    6.61 +
    6.62 +a score=381 mismap=8.33e-08
    6.63 +s 16       0 87 +    87 GTTAGTTGGGGGGTGATTGTTAAAAGTGTATATCGTTAAAAGATAAAATTTGAAATTTGGTTAGGTTGGTGTTAGGGTTTTTTGTTT
    6.64 +q 16                    B??BBBB@B@BB@BBAA?BA:?@B<<?AA>??@@C@@>@:>?4:@>@9?@<:?@@>4<@?<::?><8;?4><>?969:::<673553
    6.65 +s chrM 16124 87 - 16571 GTTAGTTGGGGGGTGACTGTTAAAAGTGCATACCGCCTAAAGATAAAATTTGAAATCTGGTTAGGCTGGTGTTAGGGTTCTTTGTTT
    6.66 +p                       %)-27;?EKQV\`beecceccfgggfdedecc_\ZUQNTZ_cedfggfcccfggfcccffccfgfccfecb_\YTOIC?<852/+'$
    6.67 +
    6.68 +a score=320 mismap=1.17e-07
    6.69 +s 18       0 87 +    87 GTTTATTATAGTTATTTTTATAATTTTCAATATTTATTTTTTTTTAGTCAATATTGGGTTTATTGTTATATCAGTTTTTTTCGTCTG
    6.70 +q 18                    (>CCCCCCBCC=ABCBB=ACCBC3*@B@C=9CBC,CA=-C@CB=CA>9?/+A+AB>)@*A@+;*=B@9CAB*?A@)B@C*C@8C=7>
    6.71 +s chrM 10589 87 + 16571 GTTCATTATAGCTACTCTCATAACCCTCAACACCCACTCCCTCTTAGCCAATATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTG
    6.72 +p                       %(+/47;@DJORUZ\^_abddfebaabcefdecbcdbbaaaaabcefccffdda`^Z]^`adbbdba`\YTQNID@=:74431.+(%
    6.73 +
    6.74 +a score=366 mismap=8.92e-08
    6.75 +s 19       0 87 +    87 ACAATATATATTTTAATAAATAATGTTTAATTGGTAATTATTATTAATTAACGTTTATAATTATATAAAGTTTTTGTATTAATAGGA
    6.76 +q 19                    =@9@B>C<';>)*8?'>67@1;(?<;A<@:@@(9A@@)(38>9+@<8?6@4:=?B976/5<@>@@/@<?1:0'9178--9=:426>@
    6.77 +s chrM 14174 87 + 16571 ACAATATATACACCAACAAACAATGTTCAACCAGTAACCACTACTAATCAACGCCCATAATCATACAAAGCCCCCGCACCAATAGGA
    6.78 +p                       &*/58=AEGJKKNRW\_cffdfedecbcec_]Z_addbbdcceccffccffdecbcedffccededfggeb`_^\ZURMIFA;72,&
    6.79 +
    6.80 +a score=364 mismap=8.24e-08
    6.81 +s 2        3 84 +    87 GGTTTTAAAAATTTTGGTGTAATTTTAAATAAAAGTAATAATTATGTATATTATTATAATTATTCTAACTTTGATTTTTTTAAT
    6.82 +q 2                     B@B>BB?B;=B@@=BBABA@<A5??'8@@>=3@47>@+AA9?;@@>@9?@(A>-9@A=(=>?1;=7=96@.4<(49=.2.1(==
    6.83 +s chrM 12300 84 + 16571 GGCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGCACACTACTATAACCACCCTAACCCTGACTTCCCTAAT
    6.84 +p                       &+.158>DJPUWZ]_dededfecbbbegfdfgggfdffdffccedededdbcdccedfeccdbbbbb_ZWTQNID@=:741.*$
    6.85 +
    6.86 +a score=329 mismap=1.29e-07
    6.87 +s 20      0 87 +    87 TTATAGTTTAATGTTTTATTTAGTTATTTTATTTTATTTTTACTGATGTTCGTCGATCGTTGATTATTATTTATAGATTATAAAGAT
    6.88 +q 20                   )@,27@CBC:1?>C?-2AA?59'<)?B7A46)@>:*?8,5)<24?)5>?;?(2@@2(1>-:<3@B5,<,3>7)?2%81,;@@BAA?B
    6.89 +s chrM 5859 87 + 16571 TTACAGTCCAATGCTTCACTCAGCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGAC
    6.90 +p                      #',06;>AEKPTX[]_acbbcedbbdbbbbdaaabcbaaaadcceedecbbccceebcdcceeba`[XUXZ[\ZXSROLIEA<60*$
    6.91 +
    6.92 +a score=369 mismap=8.81e-08
    6.93 +s 21    0 87 +    87 GATAGTATTGCGAGACGTTGGAGTCGGAGTATTCTATGTCGTAGTATTTGTTTTTGATTTTTGTTTTATTTTATTATTTATCGTATT
    6.94 +q 21                 ?BBC@@BCAC:CC@C=BCCB5=CCC@BCBCCCBBCC@BBBCC@C@3BC@BCABBB+BC:@BB>B-C@B@7B2BBABBA:1:A8A?=9
    6.95 +s chrM 80 87 + 16571 GATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATTCTATTATTTATCGCACC
    6.96 +p                    &+/5:>CFJOSY^cedeccfggfddfggfdecbbcedeccedffdecbcdbbbbceecbbbbdbbbbdb`_][WSPKHDA<950-($
    6.97 +
    6.98 +a score=383 mismap=8.06e-08
    6.99 +s 22      0 82 +    87 TGATATTTGGTTTTATGGGAGGATATAGTTTATGAAGGTTGTTGTTATAGTTGTAAGTAGGAGGATAATGTCGATGTTTTAG
   6.100 +q 22                   BBCCBCBCCCCBCCCBBCB@C@BB@BB>;@B>BC?BB@B?AAB?BAA:B?BBC@BB?BBB?A5>76A=9B:(76B8.3+7<9
   6.101 +s chrM 1407 82 - 16571 TGATATTTGGCCTCACGGGAGGACATAGCCTATGAAGGCTGTTGCTATAGTTGCAAGCAGGAGGATAATGCCGATGTTTCAG
   6.102 +p                      $*/38;>BHMPSVY^adfggggfdedffcbcedfgggfccecceccedffccedfgfdggggggfcc`[WRNKGA=841.+&
   6.103 +
   6.104 +a score=383 mismap=9.09e-08
   6.105 +s 23       0 87 +    87 TTTTATGTGATTATCGGGTTTTGTTATTTTAATAAATTTTGTTTTTGGGTGGGTGTGGGTATAATATTAAGTTGAGATGATATTATT
   6.106 +q 23                    BBBC@CBBBCCABCABBBBBBCBAB@<BB=?C<BCB:BC>@@AA@ACB?BA<9AB@@?C@BBBB:BB@BBB:@@761*B:ABABB@A
   6.107 +s chrM 13308 87 - 16571 ttttatgcgattaccgggctctgccatcttaacAAACCCTGTTCTTGGGTGGGTGTGGGTATAATACTAAGTTGAGATGATATCATT
   6.108 +p                       $'*.37<@FJNQVY]beecbbbdccdbbbcffdfgfcbbbdbbbbcfgfdfgfdfdfgfdfdffdeccffeba`\VQKGB=940,($
   6.109 +
   6.110 +a score=369 mismap=1.11e-07
   6.111 +s 24       0 87 +    87 TAATTAATATTTTTTTAGTTTTATTATTAATAATTATTATATTTTGACTATTATAATTTAACGGTTATATAGAAAAATTTATTTCTT
   6.112 +q 24                    BACBCCCACCBCCCCCCCCCACBCCABABACBCCCCCCBBCCCBCBCCCBBCCABC==BBBCBC?CCCBACBCBBCBBABCBCBCB@
   6.113 +s chrM 10081 87 + 16571 TAATCAACACCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTCAACGGCTACATAGAAAAATCCACCCCTT
   6.114 +p                       $*/26<AEILORUX[^bdbbbbdcceccffdffcceccedecbbcefcceccedffcccffdffccededed`[UOIC?<940-*'#
   6.115 +
   6.116 +a score=337 mismap=1.09e-07
   6.117 +s 25      0 87 +    87 TTTTGTAATCGTTAAATTTTGATTAATCTTATTATTCTTTGTTTAGTTTAGATATCGTTATTTTTAGTAAATTTTGATGAAGGTTAT
   6.118 +q 25                   ,B=BBCCC@25)=CB9B7;BC7>?A4A;5@BA+;6)()1BCA748@)=1?(:.A,A)?2=*A:@8A7@<3'<1@.BA,9(9A@:(:B
   6.119 +s chrM 1208 87 + 16571 TTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTCAGCCTATATACCGCCATCTTCAGCAAACCCTGATGAAGGCTAC
   6.120 +p                      $'*.37<ADFHIMSX]^`abeeccfecbbbdccda`_`abdbbceeaa`_[_acbbcbcdaaabcefdffda`^\YUOKFA;60,)$
   6.121 +
   6.122 +a score=296 mismap=1.12e-07
   6.123 +s 26      0 75 +    87 TAACAGTATTTATAATTTTCTTAATAGTTATTTTTTTTAATAATATATTTTGCGGATAATGAATTATAACTAATA
   6.124 +q 26                   A61@'(=CBBABA,AC664*>0?B@.9,BA<:=?>-B6.)*=>0?59;'3*'.<BA=?*>8<A??1)@<'/2=@=
   6.125 +s chrM 4660 75 + 16571 CAACCGCATCCATAATCCTTCTAATAGCTATCCTCTTCAACAATATACTCTCCGGACAATGAACCATAACCAATA
   6.126 +p                      $),-.26;>AEJNTX[]^_`abefdffccdbbaaaabceecffdecc`^][Y]befdfecc_ZTPMHE@:74/*&
   6.127 +
   6.128 +a score=375 mismap=9.18e-08
   6.129 +s 27       0 87 +    87 TTTAATTTTATTTTTAATTATATAATTTATTTTTTCGAGTAATTTTAATTATAATATATATATTAATAAATAATGTTTAATTAGTAA
   6.130 +q 27                    BB?>B@B@BB@B?@?BBB?A>B>AAAA?>>A;A>A@A?AA?<?=<=?A:A>>=:=??AAA>@9@:@?>9??>@@@A<?A>A777A59
   6.131 +s chrM 14124 87 + 16571 CCTAACCCTACTCCTAATCACATAACCTATTCCCCCGAGCAATCTCAATTACAATATATACACCAACAAACAATGTTCAACCAGTAA
   6.132 +p                       $'+058;?BGJMPTW]aabededffcbcdbbaaabcfgfdffcbbcefccedffdedededeccffdfgfdeb^[VROLGA=:5/+&
   6.133 +
   6.134 +a score=399 mismap=8.16e-08
   6.135 +s 28     0 87 +    87 TAAGTTAATAGAAGTCGGCGTAAAGAGTGTTTTAGATTATTTTTTTTTTAATAAAGTTAAAATTTATTTGAGTTGTAAAAAATTTTA
   6.136 +q 28                  BCAC@CC?BBCCABBBB@BCCCBAAB?@>BB@BCBBBB:CBBBB@BBBBCB@C>C<AB@B@@BBABB95@BBA@?=@?=7AA:B=:@
   6.137 +s chrM 918 87 + 16571 CAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCCTCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACTCCA
   6.138 +p                     $*058<BGKQW]adccffdedfggggfdecbbcfgfccdbbaaaaaabcefdfggfddfggfcbcdcbcffea_]YUPKE?93/,(%
   6.139 +
   6.140 +a score=342 mismap=8.43e-08
   6.141 +s 29      0 81 +    87 AGTAATAAAATTAGGAATAGTTTTTTTTTATTTTTGAGTTTTAGAGGTTATTTAAGGTATTTTTTTGATATTCGGTTTGTT
   6.142 +q 29                   ?6@C@5<(<CCB.CA?4BB=4?AA;=@CA=A<%=5>BB=15=B=>>6<B??):=>-<BA>(<@2;+%,?0805.'A7>(=;
   6.143 +s chrM 4775 81 + 16571 AGCAATAAAACTAGGAATAGCCCCCTTTCACTTCTGAGTCCCAGAGGTTACCCAAGGCACCCCTCTGACATCCGGCCTGCT
   6.144 +p                      &+/5:>DIOTW[`dfgfdfecbaaaaabbdba`abeffcbbcfgggfccdbacfggfddb```_^\ZWROIFB?:62.+'$
   6.145 +
   6.146 +a score=258 mismap=8.71e-08
   6.147 +s 3       0 69 +    87 ATCATTTTTTGGTTTGGGTATATGAATATTGTTGGGGGGAAGAGATTGATAGTAATGGTGGATGCAATT
   6.148 +q 3                    B>)(?'=@?<AABB()669@@>4BB8;*7+)=BC)383):4*;AA>11<@+%+?9)4AB>5,3;7%25#
   6.149 +s chrM 4049 69 - 16571 ATAACTTCTTGGTCTAGGCACATGAATATTGTTGTGGGGAAGAGACTGATAATAAAGGTGGATGCGACA
   6.150 +p                      #%%),/258<AEFHHIOTW\_ccfgfddbbca`^Z`dffggfggfcceda_Z[ZVQQOJGB<62-)(%#
   6.151 +
   6.152 +a score=349 mismap=1.08e-07
   6.153 +s 30      0 87 +    87 ATTATATTTATAACGTTATCGTTATAGTTTATGTATTTGTAATAATTTTTTTTATAGTAATATTTATTAGAATCGGAGGTTTTGGTC
   6.154 +q 30                   BB@<BBCBBBB@ABBB>ABB@B>BBA3>-@>BBCABAB>B6:+4BB;B8C?@?B=@BB?A;@?A?B@@B@BB@>-@:@?:>@A81>#
   6.155 +s chrM 6055 87 + 16571 ACCACATCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGCTTTGGCA
   6.156 +p                      %)-25:=ADJNSX[`abdcceccedffcbcededecbcedffdfecbaaaabbedffdffddba`^ZWTOTXYYXUPKE?;741,'#
   6.157 +
   6.158 +a score=378 mismap=8.72e-08
   6.159 +s 31      0 86 +    87 TTTGTCTTAAAAATTTTGGTTGGGGCGATTTCGGAGTAGAATTTAATTTTCGAGTAGTATATGTTAAGATTTTATTAGTTAAAGTG
   6.160 +q 31                   BBBB@,AB>B=BB:@>AA8?B<>7@A@?A@A<@@BAA>?.9,9A?A<@?A9'91-45<@25;@:5A@>?9<9?>>A<>@<@?AA>7
   6.161 +s chrM 2794 86 + 16571 CCTGCATTAAAAATTTCGGTTGGGGCGACCTCGGAGCAGAACCCAACCTCCGAGCAGTACATGCTAAGACTTCACCAGTCAAAGCG
   6.162 +p                      #&(*++.28>DJNQSVX[\]`dfgfdffcbbcfggfdfggfccceecbbbceffdffdededeccfggeba`_]YURMGD@;60*&
   6.163 +
   6.164 +a score=360 mismap=8.33e-08
   6.165 +s 32      0 87 +    87 GTTTTGTATTTATGAGTTGTTTTTATATTAGGTTTAAAAATAGATGTAATTTTCGGACGTTTAAATTAAATTATTTGTATCGTTATA
   6.166 +q 32                   BCCB@BCBBCB?BCBABB@BBBBBBBBB?BC?BBBBC<BBB@C@@=CC<<>:BC@BB78?@A@B@ABB>@B?BB>:4=;:?;3<B44
   6.167 +s chrM 8060 87 + 16571 GTCTTGCACTCATGAGCTGTCCCCACATTAGGCTTAAAAACAGATGCAATTCCCGGACGTCTAAACCAAACCACTTTCACCGCTACA
   6.168 +p                      %(+/38;@CGJPTY^bbbdbbbbbedeccfgfcccfgggfdfgfdedfecbbbcfgfdecbcffeba`\VPMID@=:::98741.)&
   6.169 +
   6.170 +a score=155 mismap=2.89e-07
   6.171 +s 33       0 44 +    87 ATAATCGTATCGGCCATATCGGTTTTATTTTTGCTTTAGTTTGA
   6.172 +q 33                    ;AA+;<B9(62;?8(6?>:;-8@;)<AB8)((>B>AA5%?####
   6.173 +s chrM 12857 44 + 16571 ACAACCGTATCGGCGATATCGGTTTCATCCTCGCCTTAGCATGA
   6.174 +p                       &*/48;@DHKOTWXX]_ba`_^[ZXWURNKIFD@=:74/+'%$"
   6.175 +
   6.176 +a score=423 mismap=7.98e-08
   6.177 +s 34       0 87 +    87 GAATGGGTATAATGAGGAGTAGGAGGTTGGTTATGGGTATGTTGTTAAGAAGAGGAATTGAATTTTTGATTGTAAAGTTTTAAGTTT
   6.178 +q 34                    BCABBBBCBBBCAACB;BCAB@BBBBBCABBA?AB>B@5@B@BA5BCB7?BABBA:B:++8BAB@BA:-<BABBA@2BBA@@A9><7
   6.179 +s chrM 13224 87 - 16571 GAATGGGTACAATGAGGAGTAGGAGGTTGGCCATGGGTAtgttgttaagaagaggaattgaacctctgactgtaaagttttaagttt
   6.180 +p                       &,15;AFJOSY^`dfggggegggggfccffccedfgfdedecceccfgggggggggfddfgfcbbbceeccca_ZUOIEA>;61+'$
   6.181 +
   6.182 +a score=357 mismap=8.46e-08
   6.183 +s 35      0 87 +    87 TTTCTTTTATTTTTGAGTTTTAGAGGTTATTTAAGGTATTTTTTTGATATTCGGTTTGTTTTTTTTTATATGATAAAAATTAGTTTT
   6.184 +q 35                   ?BC?CAAB@B=CCCCBBB@B@>@@BBACB?@B@CB@CBACC>A4BBACAAB?B@C@@B:5B@@@A?.=A8B>A?A;8;?@?A:===6
   6.185 +s chrM 4796 87 + 16571 CCCCTTTCACTTCTGAGTCCCAGAGGTTACCCAAGGCACCCCTCTGACATCCGGCCTGCTTCTTCTCACATGACAAAAACTAGCCCC
   6.186 +p                      #&),036:>ADHKOUZ^``abfgggfccecbcfggfdebbaaabcefdecbceecbcdbbaaaaabbededec_\WRLF@<94.*'$
   6.187 +
   6.188 +a score=367 mismap=8.07e-08
   6.189 +s 36       0 87 +    87 GTTGTAGTATATTTAAAGATAATTATTATTTTTTTTAAATAAATTAAAAAAATTATTAAATTTATATAATTTTTTTTAAACTTTATA
   6.190 +q 36                    BB:@@BCB4BBCB?*@A>BB>99BCBBCC>53B<<(>)(<9(87:3B??CBCCBCBCBBCCBB->@1?+?@:@@B??177'71;A##
   6.191 +s chrM 14459 87 + 16571 GCTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAAATTAAAAAAACTATTAAACCCATATAACCTCCCCCAAAATTCAGA
   6.192 +p                       %)-26;ADIMRUX[`dfgfdffcceccdbbaaaaabeeedfffccfgggggfcceccfgfcbcedecc`[WTQNKHEB=821/,*%#
   6.193 +
   6.194 +a score=378 mismap=8.07e-08
   6.195 +s 37       0 87 +    87 TAGTTTTATTATTAATAATTATTATATTTTGATCATTATAATTTAATGGTTATATAGAAAAATTTATTTTTTACGAGTGCGGTTTCG
   6.196 +q 37                    BBAA;6BBB6@BC=>B>C@C<BBB??@CBACBA+C=@AB?BB8@?@<66BA@B>BA@B:ABAB?2AA7A@@8A<3B+AB85B>=<<B
   6.197 +s chrM 10096 87 + 16571 TAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTCAACGGCTACATAGAAAAATCCACCCCTTACGAGTGCGGCTTCG
   6.198 +p                       $*/258<ADHMPTY^`cdccdccedecbbcefcceccedffcccffdffccededfgggggfcbcdbbaaaaa^[VQKGB>93/,(%
   6.199 +
   6.200 +a score=206 mismap=9.09e-08
   6.201 +s 38       0 87 +    87 TTGTTCGTAGTGCGTCGATTAGGGCGTAGATTGAGTTTGATGGTTATTTGCGTCTAACCGGTCATGCAATGCATGAGATACACTCTC
   6.202 +q 38                    <?)8)?@:>>*B7/C+C?9@(B?5@*B)7%5A5C7@A+49(2%/;03B?######################################
   6.203 +s chrM 12858 87 - 16571 CTGCTCGCAGTGCGCCGATCAGGGCGTAGTTTGAGTTTGATGCTCACCCTGATCAGAGGATTGAGTAAACGGCTAGGCTAGAGGTGG
   6.204 +p                       $'+.15:>CHKQTY\_cecceggfddcca]_aefd`^[YTNKFECA=96320//...--,,+++***))(''&%%%%$$$$##""!!
   6.205 +
   6.206 +a score=366 mismap=9.32e-08
   6.207 +s 39      0 87 +    87 AATGGTATTGAATTTACGAGTATATCGATTACGGTGGATTAATTTTTAATTTTTATATATTTTTTTTATTATTTTTAGAATAAGGCG
   6.208 +q 39                   B?=BBBBB?B@BABBB=@BABBAAA@BBAA>;0===8>=;7.5:<;@@@A@<8A>351:@A2(;>@9-;73:7;<34.962+:=;.6
   6.209 +s chrM 7893 87 + 16571 AATGGTACTGAACCTACGAGTACACCGACTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAGAACCAGGCG
   6.210 +p                      &+/5:>CFJPVZ]_addfgfdedeccffccedffdfgfccfecbbbceecbbbcededebaa`aaabdba`\YVSPMHB=7321.)&
   6.211 +
   6.212 +a score=408 mismap=8.02e-08
   6.213 +s 4       0 87 +    87 CGTCGTCGGGAAAAAAGGCGGGAGAAGTTTCGGTAGGTTTGAAGCTGTTTTTTCGAATTTGTAATTTAATATGAAAATTATTTCGGA
   6.214 +q 4                    ?BCC@?CCBCC@CBCACCCCCCCC@ABCCAABBCCBC@A=B@CBCACCC@BCB@?CCACBCBBBBB>C>@>BBB?BBB:=<B@B>BB
   6.215 +s chrM 5737 87 + 16571 CGCCGCCGGGAAAAAAGGCGGGAGAAGCCCCGGCAGGTTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAATCACCTCGGA
   6.216 +p                      $),059<BHNTZ_dfggfdgggggggfcbbcffdfgfcccfggfccdbbaaabcfffcbcedffcbcffdecda\VPJFC>:741,&
   6.217 +
   6.218 +a score=354 mismap=8.27e-08
   6.219 +s 40      0 87 +    87 ATTAATATTTTTAATTTTATTTATTTTTTTTTTTTTAGGAGGTTTGTTTTCGTTAATCGGTTTTTTGTCTAAATGGGTTATTATTGA
   6.220 +q 40                   BB?BBBBBBBBCBBABBAB?B@@B<9BAB>BA@BBB<@BA@ABAAAB=:@BB:BAAB=<>@?4<@B@A@?9=?@=.4?9:+778;32
   6.221 +s chrM 5186 87 + 16571 ACTAACACCCTTAATTCCATCCACCCTCCTCTCCCTAGGAGGCCTGCCCCCGCTAACCGGCTTTTTGCCCAAATGGGCCATTATCGA
   6.222 +p                      %)-28;@CFIMPVZ]^`adbbbdbbaaaaaaaaabcfggggfcbcdbbbbbdccffccfecbaabbdcbceec^[VPJFC>:72.+&
   6.223 +
   6.224 +a score=292 mismap=9.45e-08
   6.225 +s 41       0 87 +    87 TTTCGTTCGTTTTTTTTTCTTTATAAAATTTTTTTTAGTAGTTATTATTTTTTTATTATTTGATATAGAAATTGATTTTCTTTTATT
   6.226 +q 41                    *);9:14@3>,B?05:B9BA@2=87@>3><(=?9-)3=;/=@:BB@B@0?;>:A09>@4;3>915@2>08;<7.'2;>>8A:+81;A
   6.227 +s chrM 10193 87 + 16571 CCCCGCCCGCGTCCCTTTCTCCATAAAATTCTTCTTAGTAGCTATTACCTTCTTATTATTTGATCTAGAAATTGCCCTCCTTTTACC
   6.228 +p                       #%),1468:;;>ADGJMPSVY\abeggfba`aaaabefdffcceccdbbaaabbdccdba_^ZTQTY]]ZUPLHCCA?=;852/,'$
   6.229 +
   6.230 +a score=397 mismap=8.45e-08
   6.231 +s 42      0 87 +    87 AGGTTAAATATAGATTAAGAGTTTTTAAAGCCTTTAGTAAGTTGTAATATTTAATTTTTGTAATAGTTAAGGATTGTAAAACTTTAT
   6.232 +q 42                   B88>BCBB4BABB=BB>;B=<?BB:?AB?@AB?@B>9A?A@A?A>@?@4?>>@?B<@@6B=@<B55:7(25A:?7>=>;@;@?5(9@
   6.233 +s chrM 5520 87 + 16571 AGGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGCAACAGCTAAGGACTGCAAAACCCCAC
   6.234 +p                      &,148>DIMRV\acccfgggfcbbbcfggfcbbbcefdfgfccedffdecbceecbbbcedffdffcceffea\XUPLGA<62.+($
   6.235 +
   6.236 +a score=240 mismap=9.59e-08
   6.237 +s 43      0 75 +    87 AAAGAGTATGATGGGGTGGTGGTTGTGGTAAATTCTAATAGTGTAGGTCCTGCATTGCTGGGGCTGGAAGGCACG
   6.238 +q 43                   BC@BCCCC=B=BBB@B@A@B?B@B9AAB>>BBBA):B<>??05:?7@############################
   6.239 +s chrM 2215 75 - 16571 AAAGAGTATGATGGGGTGGTGGTTGTGGTAAACTTTAATAGTGTAGGAAGCTGAATAATTTATGAAGGAGAGGGG
   6.240 +p                      &,28>CGLPV[^cfgfdffdffccedffdfgfcbabca]YTOKEB<71.,*))('&%%$$$$#######"""!!!
   6.241 +
   6.242 +a score=148 mismap=2.17e-07
   6.243 +s 44       0 86 +    87 GTTAGTAGTGTAGTGATGTTAGGAGTTAGGATTAGAGGAATCCCCATGTACAGACCGCCAGTGGGTCGTGAATCTGGGCTGCTATT
   6.244 +q 44                    >*>C+3(>:'<CC?B@-7'':0%'@-B@40@>6#####################################################
   6.245 +s chrM 10035 86 - 16571 GTTAGTAGTATAGTGATGCCAGCAGCTAGGACTGGGAGAGATAGGAGAAGTAGGACTGCTGTGATTAGGACGGATCAGACGAAGAG
   6.246 +p                       %(,27:>ABCGLRU[_acaaca]__[XUPKE?;86433210//..-,++*)))('''&&&&%%%%$$$$$######"""""""!!!
   6.247 +
   6.248 +a score=376 mismap=7.99e-08
   6.249 +s 45      0 79 +    87 GTCGTAGATGTCGTTGGAAATGGTGAAGGGAGATTCGAAGTATTTTGAGGTTTGTAGGATGGTAAAATAGAGATTTAGT
   6.250 +q 45                   B@9?CBBABB@BBBBAC=BBABA??BB@@4?A@BA66BB@B8B7A@<BB0(?<=6%5>9)3;6>@4,;399?@</145:
   6.251 +s chrM 6782 79 - 16571 GCCGTAGATGCCGTCGGAAATGGTGAAGGGAGACTCGAAGTACTCTGAGGCTTGTAGGAGGGTAAAATAGAGACCCAGT
   6.252 +p                      %)-26<AGJORV[]`dfggfdffdfgggggggfcccfggfdecbbcfggebbcecdfea\addffd_ZVQKE?952/*$
   6.253 +
   6.254 +a score=384 mismap=8.22e-08
   6.255 +s 46       0 87 +    87 AGTTTTTTTTTTATAATAATATTTATGTGTTTAGATTAAGAAGTTATTATTTCGAATTGATATTGAGTTATAATTTAAATAATTCAG
   6.256 +q 46                    BC>>ACA?BBBB>B?>CCC@ABBB@BB@>?BABBABB;789@B??@@<C?BBBAA@A?@4A@A@B@<19@.4A=:B@=B<B7<@@@B
   6.257 +s chrM 12475 87 + 16571 AGTCTCTTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTCGAACTGACACTGAGCCACAACCCAAACAACCCAG
   6.258 +p                       &+.147:=@CFJOSY^`dedecbcededecbcfgfddfggggfcceccdcbbcfgfccffdeccfgfcceddb^ZXUPJD@;52.+&
   6.259 +
   6.260 +a score=365 mismap=8.47e-08
   6.261 +s 47      0 87 +    87 GTAGATTTAATTATTTTTTTTTTATATTTAGTAGGTGTTTTTTTTATTTTAGGGGTTATTAATTTTATTATAATAATTATTAATATA
   6.262 +q 47                   AC>=ABBAA@CB6BCCB9?BAB=CCB@<B;C<CA@C@,9CCBAB>?=BBAB@A34@(86<CBBCB<<B=BA@@B=A92A?826;:B>
   6.263 +s chrM 6330 87 + 16571 GTAGACCTAACCATCTTCTCCTTACACCTAGCAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATCAATATA
   6.264 +p                      &*05:=ADJORVZ\^_`aaaabbedecbcffdfgfdebbaaaabbdbbbcfgggfcbdcceecbbbdccedec^[VPLID@=83/)&
   6.265 +
   6.266 +a score=366 mismap=8.3e-08
   6.267 +s 48      0 86 +    87 TAAGTTTTTGACTTTTATTTTTTTTTTTTTTATTTTTGTTCGTATTTGTTATAGTGGAGGTTGGAGTAGGAATAGGTTGAATAGTT
   6.268 +q 48                   BCBBB@BBBB@BBB?BB>B?BBBAB@>A?B?<AAAB>B9BAB<@A@>ABA87AAAB?A@?BABBA@B:A@B=:@<8:<477<@??9
   6.269 +s chrM 6202 86 + 16571 TAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCTGCTCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTC
   6.270 +p                      $*058;>AEKORUX[^aaaaaaaaaaaaabbdbbbbbdcbcedecbcdccedffdfgggfddfggfdfgggea_ZTOKGB=73.($
   6.271 +
   6.272 +a score=369 mismap=8.84e-08
   6.273 +s 49       0 87 +    87 TATGATTTATTTTATATTTTAATTTATGAGATTTATAATAAATAGTTTTTTTAAATGTTAATTTAAGTTTTATTTTATTATTAGGTT
   6.274 +q 49                    BCBCBBCCCBB?BBB6CBCCB@@@BAA@C?BB@B@B@?BBC?B@B@@BBB>BBA5@BB<>B=?@A4B>?>?BA==>?B?=@B:<=@B
   6.275 +s chrM 12896 87 + 16571 CATGATTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAACGCTAATCCAAGCCTCACCCCACTACTAGGCC
   6.276 +p                       $*-38;>BGJMPTY\``abceecbcedfggfcbcedffdfgfdfecbaaabcfgfdeccfecccfffcba``\YVSPKGD?<83.($
   6.277 +
   6.278 +a score=280 mismap=9.01e-08
   6.279 +s 5        0 87 +    87 GGGGTATCGATTATTAGGGGAATTTGTTAGTTGTTAAAGTTTTCGATTATGATGGGTATTATTATAACAGTTGCTAAGAAGAACCCA
   6.280 +q 5                     BC?CCCBAABABBC>@>=BB5C>BB?B3B;BB<CB4A.B/@86B?/7>5?@@>@?>6::B</<8A######################
   6.281 +s chrM 10398 87 - 16571 GGGGCACCGATTATTAGGGGAACTAGTCAGTTGCCAAAGCCTCCGATTATGATGGGTATTACTATGAAGAAGATTATTACAAATGCA
   6.282 +p                       &,27;@CGMRUX]_aeggfd`[UQNSVZ_bbcdccfggfcbbbcefccedfeba]XRNIEB=961-+*(''&%%$$$####"""!!!
   6.283 +
   6.284 +a score=151 mismap=1.69e-07
   6.285 +s 50      0 36 +    87 TGGGTTAGTTAGGTAATTTTTTAGGTAACGATGATA
   6.286 +q 50                   ?)3<2A>:>*?6<B8>@7BB@<@B@>B0*(26)8B<
   6.287 +s chrM 6025 36 + 16571 TGGGCCAGCCAGGCAACCTTCTAGGTAACGACCACA
   6.288 +p                      $)/47;AFILRX]_cdba`^][XTNHD?962,((&$
   6.289 +
   6.290 +a score=378 mismap=9.54e-08
   6.291 +s 51      0 87 +    87 AAAATAATTGAAATTAAATAATTTAAGTATTGTTTATTATAATTTTATTGGGTTTTTATTTTATTTTTTTATAAGTTTTAGAGTATT
   6.292 +q 51                   BCCCCBCCCCBBBBACCBACBBA@C@CBCBBCCBAACBCACBC@CBBCABBBBBBCAA<BAC@;?@CB>BBABBBABABB@@BBBBA
   6.293 +s chrM 9664 87 + 16571 AAAACAACCGAAACCAAATAATTCAAGCACTGCTTATTACAATTTTACTGGGTCTCTATTTTACCCTCCTACAAGCCTCAGAGTACT
   6.294 +p                      &,27;AFIMSY^bbcfgfdffcccfgfdeccdcbcdccedfecbbcdccfgfcbbbbdbbbbdbbaaabbdcc_ZTQMJGB=71-($
   6.295 +
   6.296 +a score=147 mismap=1.72e-07
   6.297 +s 52       0 43 +    87 TTTATATTTTTTTTATAACGCTTAGAAGGAATCACCTTATCGT
   6.298 +q 52                    :-*<%<=>@;@='5'8())-=:>CB3:1%3:7%8%'?6>,235
   6.299 +s chrM 10545 43 + 16571 CTCATATCCTCCCTACTATGCCTAGAAGGAATAATACTATCGC
   6.300 +p                       #'*.158;>ADFIKMNOSVZ\_addb^XRNHB>=97653/,)$
   6.301 +
   6.302 +a score=386 mismap=8.07e-08
   6.303 +s 53       0 87 +    87 TGTTGTAGTATATTTAAAGATAATTATTATTTTTTTTAAATAAATTAAAAAAATTATTAAATTTATATAATTTTTTTTAAAATTTAG
   6.304 +q 53                    BBB?@ABBBBCBB*BBA@@B>@B<@??B<?BA@?AB8B<?B::@??6<A@?A<?@A@@@7:B8?@9@?<@<@B<=;A??@:=1?:.5
   6.305 +s chrM 14458 87 + 16571 CGCTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAAATTAAAAAAACTATTAAACCCATATAACCTCCCCCAAAATTCAG
   6.306 +p                       $),069?DHMQUXZ^bfggfdffcceccdbbaaaabcfgfdfgfddfgggggfcceccfgfcbcedededa^\ZWTQOLGA;52.+&
   6.307 +
   6.308 +a score=382 mismap=7.99e-08
   6.309 +s 54       0 86 +    87 GATTGTTGTGATTAGGACGGAATAGACGAAGAGGGGTGTTTGGTATTGGGTTATGGTAGGGGTTTTTATATTGATAATTGTTGTGT
   6.310 +q 54                    =CCB@9CCCC<BCBB7ABC?<'*?C8A85A47?<B@7>;0+?BA,A48BCB(';@>=B68B?*CB>6A;*<>C?B40=2-6:@5@#
   6.311 +s chrM 10088 86 - 16571 GACTGCTGTGATTAGGACGGATCAGACGAAGAGGGGCGTTTGGTATTGGGTTATGGCAGGGGGTTTTATATTGATAATTGTTGTGA
   6.312 +p                       &+.27:>CGMRUY^cffded`[^befdfgggggggfdecbcffdeccfgfcbddffdfgfd_Z\^`adcca_]YSOJD@=841,(#
   6.313 +
   6.314 +a score=372 mismap=8.18e-08
   6.315 +s 55    0 87 +    87 AGCTTTTTATGTATTTGGTATTTTCGTTTGGGGGGTGTGTACGCGATAGTATTGCGAGACGTTGGAGTCGGAGTAATCTATGTCGTA
   6.316 +q 55                 BBCBBBBC@C>B@B?@BBBBABAAB?A@B@BB>BBB?AACA@@BABBBBABA:A@@B>@AB@A:BAAA8B?@@A<43><?A?:>??A
   6.317 +s chrM 36 87 + 16571 AGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCA
   6.318 +p                    &+.147:>CGLPUXZ^bdcebbbbbdcbcfggggfdededededffdffdeccedfggfdeccfggea_]YSMGD>>>>=;951.)&
   6.319 +
   6.320 +a score=411 mismap=8.33e-08
   6.321 +s 56      0 87 +    87 TTATGGTGAGTTTAGGTGATTGATATTTTTGATGCGAGTAATACGGATGTGTTTAGGAGTGGGATTTTTAGGGGATTTAGTGGGGTG
   6.322 +q 56                   BABABBBABAABB@@BB>AABA<@A@@?@>AAA?@B?@?@=>>@?@@AAA@;B>>?A@;?B?AA>?A?>@=:=?@<553@?>@;?<;
   6.323 +s chrM 6915 87 - 16571 CTATGGTGAGCTCAGGTGATTGATACTCCTGATGCGAGTAATACGGATGTGTTTAGGAGTGGGACTTCTAGGGGATTTAGCGGGGTG
   6.324 +p                      $(-17<@FKPSVZ_cedffccffdecbbbcefdedfgfdffdfdfgfdedecbcfggggdfggfcbbbcfggfc^YUROJDA;60*&
   6.325 +
   6.326 +a score=313 mismap=1.19e-07
   6.327 +s 57       0 85 +    87 TTAGTAGGTTTTTTTTTTTTATTTATTTTATTAATTTATATTTATAATATGTTAGGTTTATTAAATATTTTATTATTGATTTTTA
   6.328 +q 57                    BB=C>;>+>?B@B@@CB@A+5A?'=A;(8<BABB@=>@>@98BB@BA@;2'=47B>7:AB=;('>@?????@7<AA7'8<-8?=@
   6.329 +s chrM 11219 85 + 16571 CTAGTAGGCTCCCTTCCCCTACTCATCGCACTAATTTACACTCACAACACCCTAGGCTCACTAAACATTCTACTACTCACTCTCA
   6.330 +p                       $(.37=BGJMPSUX[]^`abdbaab_][^abceecbcedecbcedfeba]Z]_dffcbcdccdeda^ZVSPMHEA<95530.+(%
   6.331 +
   6.332 +a score=397 mismap=8.23e-08
   6.333 +s 58      0 85 +    87 GTTGGAGTGTAGGATAAATTATGTTAAGGCGAGGATGAAATCGATATCGTGGATACGGTTGTATAGGATTGTTTGAATGGTTGTT
   6.334 +q 58                   B>66?C>C?8+:B@BCABB=>BA5B>AAA9CB<A4?A@@ABAB@>@@;B:%+7?)2;35A*=>@>B?@>B<A+@--1;5A>@=<:
   6.335 +s chrM 3652 85 - 16571 GTTGGAGTGTAGGATAAATCATGCTAAGGCGAGGATGAAACCGATATCGCCGATACGGTTGTATAGGACTGCTTGAATGGCTGCT
   6.336 +p                      %)-39>DGMQV\addfgfccedeccfggfdgggggdfggfccffdecbc`]bdcddffccdcedfggfba`\YVSNIC?:40,($
   6.337 +
   6.338 +a score=361 mismap=8.25e-08
   6.339 +s 59      0 82 +    87 AAAAGAGTAAGATTTTTATTAATAGATGGAGATATATAGAAATAGCTAAATTATATTTATAGAATGTTAGTATTAGGCGTAG
   6.340 +q 59                   BCA=8@>:B>AB9B-B?A0*:BABB?B?=6><?<BA@5A99>024)?B>A@:>@@A9<:7)4=,3=6;+)@/>AA<@1?###
   6.341 +s chrM 6572 82 - 16571 AAAAGAGTAAGACCCTCATCAATAGATGGAGACATACAGAAATAGTCAAACCACATCTACAAAATGCCAGTATCAGGCGGCG
   6.342 +p                      &,28>DIMSY^aaaabbdcbefdfgfdggggfdededfgggfdfebcfgfccecdba_^ZVRW\^`^\YUPLGC@;5/+&#"
   6.343 +
   6.344 +a score=368 mismap=8.65e-08
   6.345 +s 6        0 87 +    87 TTATATTTTATATTTTTTTCGAAATTATATTTATTTTTATTTTGGTTATTATTATTCGATGAGGTAATTAGTTAGAATGTCTGAACG
   6.346 +q 6                     BBB?C<@BA;5AB:AB@B?B<AB>A<AB:@AB9;=@AA43A>@;,5=@@A@/@>@=:?:@>><>-=6@746?=05?*?<<==9775=
   6.347 +s chrM 11106 87 + 16571 TCATATTTTATATCTTCTTCGAAACCACACTTATCCCCACCTTGGCTATCATCACCCGATGAGGCAACCAGCCAGAACGCCTGAACG
   6.348 +p                       $(-058;?BGKORTVWYZ\^begfccedecbcdbbbbbdbbbcefccecceccdcbcffdfggfdffccfecba]XRMID@=:50*&
   6.349 +
   6.350 +a score=383 mismap=8.82e-08
   6.351 +s 60      0 87 +    87 GTAGAGATTTGAAGAATTGATTAATGTTTGGGTTTGAGTTTATATATTATAGTGAGAATTTTATGATGGATTATGTAACGAATAATG
   6.352 +q 60                   B>B>=)=(@3:87/;7;(;:B8((:+@<)@7<B@:27(<ABAABAAB@=5()-@,1)>7.2A?@9=@?60((5=15A=31<@:?>@#
   6.353 +s chrM 3870 87 - 16571 GTAGATATTTGAAGAACTGATTAATGTTTGGGTCTGAGTTTATATATCACAGTGAGAATTCTATGATGGACCATGTAACGAACAATG
   6.354 +p                      &).2449;?CINTZ_bbbeeccdedecbbeffcccffecbcededeccedeedfggffcbbcedffdffebab`^YVQKGB<62-'#
   6.355 +
   6.356 +a score=196 mismap=1.36e-07
   6.357 +s 63       0 78 +    87 ATTGATTTATTCTTTAATAATCGTTATGTATTTCGTATATTATTGTTAGTTGGTTAGAGTATTGTCCGGGACGCCATT
   6.358 +q 63                    3)>(<@))@A*<*>(0(94<:0)<+BA:>:7>B8'?%66-?>B5).A6@0=###########################
   6.359 +s chrM 16062 78 + 16571 ATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAA
   6.360 +p                       %(,057:=@BCDDGKPUX^aabcccededecbbbcbbaa]ZWROKGC@;62/-,++**)((''&&&%%%$$##"""!!
   6.361 +
   6.362 +a score=345 mismap=8.19e-08
   6.363 +s 64       0 87 +    87 TAGCTTAATTAGGTTTTTAGTTTTGATTTTTTTTAGTTATAGAAGGTTTTATTTTAGTTTTAGTTTTATTTTATTTAAGTATTATAG
   6.364 +q 64                    BCCCAC@CCACCCC=CCCC0CCCCCCACCCBCCCCCCC@CCBC>C@CBCCA<BBCBCACBCB@?B@BB?@@B@@,;BB?A?AB>BB=
   6.365 +s chrM 13007 87 + 16571 CAGCCCAATTAGGTCTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCCCAGTCTCAGCCCTACTCCACTCAAGCACTATAG
   6.366 +p                       $*/259?DGKQV[\]]\ZXSVY\_cdbbaaaabcefccedfggggfcbbbdbbbceecbbceecbbbdbbaaa]ZWUPJD@;74/+&
   6.367 +
   6.368 +a score=359 mismap=8.27e-08
   6.369 +s 65       0 86 +    87 TAATGGGGTTTATTTATTTATTATATTAATAATATAAAATTTTTATTTATACGAGAAAATATTTTTATTTTTATATATTTATTTTT
   6.370 +q 65                    0AAA;B;B>;>:06<BBB>??A@?BBBB?BC/BB>=B:A+;2<@B@??B>BBC=B6';B=BABBABA+'.>4@AB?B869@.<-/>
   6.371 +s chrM 12002 86 + 16571 CAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCACACGAGAAAACACCCTCATGTTCATACACCTATCCCC
   6.372 +p                       $*/39?EJMPTX[]`cbbbdccedeccffdffdfdfggfcbbbbdcbcededfgggfgfdebbaaa`\YZYWUQNIE@<951-*'$
   6.373 +
   6.374 +a score=363 mismap=8.87e-08
   6.375 +s 66       0 87 +    87 GTTTTAATCGTTTTTTTATTAATCGTTTATATTATTTGAGACGTAAATTATGGTTGAATTATTCGTTATTTTTATGTTAATGGCGTT
   6.376 +q 66                    BBC?CCBBB9@CACB@BBB>@BB@BBB<?B1?87+2=A=8/<)8;7@4;@B>AA:B@B<'86@6<48,.=?</</:82>>B<';=@A
   6.377 +s chrM 14921 87 + 16571 GCCTCAACCGCCTTTTCATCAATCGCCCACATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCC
   6.378 +p                       %(,/38=ADILORUX[]abceeccdcbcedeccdcbcfggfdedfgfccedffccfgfcbdbbcdccdba``_]YUPMID?;60-($
   6.379 +
   6.380 +a score=398 mismap=8.27e-08
   6.381 +s 67      0 87 +    87 TGTTTAGGAGTGGTATTTTTAGGGGATTTAGTGGGGTGATGTTTGTTGGGGGCTAGTGTTTTTTTAGTTGGGGGGTAGGGGTTAGGT
   6.382 +q 67                   A8B<BB;?<B;BB+=B??7>>7A?><A7>@A<<BBB99@BA@B92??@<8@3<3AAA3?@@?<@4@:<14A?A::<>?59?7?1179
   6.383 +s chrM 6964 87 - 16571 TGTTTAGGAGTGGGACTTCTAGGGGATTTAGCGGGGTGATGCCTGTTGGGGGCCAGTGCCCTCCTAGTTGGGGGGTAGGGGCTAGGC
   6.384 +p                      $),049?EKPSVWV[]_`abeggggfcccffdfggfdffdecbcdccfgggfccffdebbaaabcefccfgggea\YTNHB<850*$
   6.385 +
   6.386 +a score=401 mismap=8.06e-08
   6.387 +s 68     0 87 +    87 TAGTTTATATTATAAGGATAGGTTTATTTGAGTATTTTGTTTTTAATTAGGGAGATAGTTGGTATTAGGATTAGGATTGTTGTGAAG
   6.388 +q 68                  B?6??BBA?@>=>A4>BBBABB9(<@???B@6=<B18@A.A26>6@=>ABB6/3AA;???A>-7B@3=@@AB=B@?@956??<59:=
   6.389 +s chrM 664 87 - 16571 TAGTTTATACTACAAGGACAGGCCCATTTGAGTATTTTGTTTTCAATTAGGGAGATAGTTGGTATTAGGATTAGGATTGTTGTGAAG
   6.390 +p                     $*/259>BGJNSW]beffdfgfcabdcbcfgfdecbbbdbbbbcefccfgggggfdffccffdeccfggfccdc^YSOLGC@;72,&
   6.391 +
   6.392 +a score=349 mismap=9.43e-08
   6.393 +s 69      0 87 +    87 GATTAATGGGATTTAAATTTAAAAATATTTAGTTAATAGTTAAGTATTTTAATTAATTGGTTTTAATTTATTTTTTTCGTCGTCTGT
   6.394 +q 69                   B>BB;1ABB?@9ABAABAB@4)?@A>(@>>*>>53A<>0@>@BAA@:7;)@<?AA@AB2',(@((0A@>?=7:>?A@B:@'?.<###
   6.395 +s chrM 5660 87 + 16571 GACCAATGGGACTTAAACCCACAAACACTTAGTTAACAGCTAAGCACCCTAATCAACTGGCTTCAATCTACTTCTCCCGCCGCCGGG
   6.396 +p                      &+/28=AGMSWZ]`dfeba`^Z_cecdbbcdeccffdffccfgfdecbbbeeccffccedbaaacda_][VROLIFC@=852-*'$"
   6.397 +
   6.398 +a score=340 mismap=9.13e-08
   6.399 +s 7        0 85 +    87 TTATAAGTATTAATTAATTAATATATTTTAGTAGGTATGTTTGCTTGTAATATTGAATGTAGGAGCGATAGATAAGAGAATTAGG
   6.400 +q 7                     BCC@>CCBCBBCBCBB;B?6,:>@?BB<?:+4>89ABBB@AB?):B=5=1@@49;;9;<9(22+/+>?060.=<4++276;####
   6.401 +s chrM 16343 85 - 16571 CTACAAGCATTAATTAATTAACACACTTTAGTAGGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGAATGAGG
   6.402 +p                       $(-17<BEJNQW\^`deccffdedecbbcffdfgfdedecbbdbbcedffdeccfgfdecca]WYYXTOKFFEDA=<;83-)'%#
   6.403 +
   6.404 +a score=340 mismap=8.71e-08
   6.405 +s 70      0 84 +    87 TATTTTTTTTATTTGTTTTTTAGTTTTGTATGTTTTTTTTTTAATATTTATAATAAAATTAATTAATATTAATATTTTAGACGT
   6.406 +q 70                   ?ACBCCCCCACBCBCCC=CCC>@7BCAACCBCBC?CBCCACCCC@ACC?AC@BA<C>CACC?@CBBBC67;@)=@>@A*=:B@8
   6.407 +s chrM 7675 84 + 16571 CATTTTCCTTATCTGCTTCCTAGTCCTGTATGCCCTTTTCCTAACACTCACAACAAAACTAACTAATACTAACATCTCAGACGC
   6.408 +p                      $),/258;>BGJMQUX[]_`beecbbcededebbaaaaaabcefdecbcedffdfggfccffccffcda^\XROJFC@=93-*$
   6.409 +
   6.410 +a score=348 mismap=9.46e-08
   6.411 +s 71       0 87 +    87 TTTTTTTTTTTTTTTTTTTAATGATATTAATATTATTTTTATCAGATTTTTTAGGCGATTTAGATAATTATATTTTAGTTAATTTTT
   6.412 +q 71                    BCCAB>CBCBBB>?BC@BB?BBB@@A>B?A@BBA<BB??BBBBBBBAB@B@@<A5<=>BABA?A.<,B@ABB@B=88B?@<7@?AAB
   6.413 +s chrM 15444 87 + 16571 TTCTCTTCCTTCTCTCCTTAATGACATTAACACTATTCTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCT
   6.414 +p                       #&),/258;>ADGJMPSWZ_ccffdeccffdeccdbbbbbdccfgfcbbbbcfgfdffcccfgfdffccc`^ZVSPMHC?<71-*'$
   6.415 +
   6.416 +a score=280 mismap=9.7e-08
   6.417 +s 72       0 84 +    87 TTATTATTACAAACAAAATTTTATTTTTTTATAGTAATTTTTTTATAAATTTTTTCAATTTTAATATTTAGAGTAATAGATTTA
   6.418 +q 72                    BAAC?BA=18%<A*=C=1=8*0B@;??9:'@A:.B:A3*7B@6/:AB@B@A2A@C)3,?8%-,524A:)2(B@8(<>=0A):(@
   6.419 +s chrM 11021 84 + 16571 CCACTATCACGAAAAAAACTCTACCTCTCTATACTAATCTCCCTACAAATCTCCTTAATTATAACATTCACAGCCACAGAACTA
   6.420 +p                       $(,038;>BDEIKLQW]``a`bdbaaaa```]ZUY^aa`aaabbedfgfcbaaaabdda`^`b`[XSOLIEDB?;;973.('%$
   6.421 +
   6.422 +a score=321 mismap=8.84e-08
   6.423 +s 73      0 86 +    87 TGCGGGAATAATGATATATGTTTTGTTTTTGTTGAGTGTGGGTTTAGTAATGGGGTTTGTGGGGTTTTTTTTTAGGTTTTTTTTTA
   6.424 +q 73                   BA9@+@B@)@C?CCBC8CCCCBBB/37A-ABC>B@4><+==@+>2@BBBCBBCB@*=???:BA?+<BB-9@A?>)0?>-8*;-9=?
   6.425 +s chrM 1887 86 - 16571 TGCGAGAATAATGATGTATGCTTTGTTTCTGTTGAGTGTGGGTTTAGTAATGGGGTTTGTGGGGTTTTCTTCTAAGCCTTCTCCTA
   6.426 +p                      $(*+,27<?DHIJJJIMRUZ\^`acbbbbbdccfgfdfdfgfcccffdffdfggebbcedfgfc_[YVSPMJGD??=;9631.+(%
   6.427 +
   6.428 +a score=240 mismap=9.6e-08
   6.429 +s 74       0 84 +    87 TATTTATTCTATTAAAGTAATTTTTTTATTAGATATATTTCCTAGGTTTGAGGGTTTATTCGGCAGCTCAGTATCTACACCAAG
   6.430 +q 74                    B>C>*3B6)<CBA;=@3AC:B3BBB;A>)@A?CCBBCB:3>)*@B=+??CC<:8##############################
   6.431 +s chrM 12266 84 - 16571 TATTTACTCTATCAAAGTAACTCTTTTATCAGACATATTTCTTAGGTTTGAGGGGGAATGCTGGAGATTGTAATGGGTATGGAG
   6.432 +p                       $),/27:=?CHKOU[`ccfecbaaabbdbcfgfdedebbaa`adda]YVSNIC=7420.-,,++*)('&&%%%$$###""""!!
   6.433 +
   6.434 +a score=397 mismap=8.17e-08
   6.435 +s 75       0 85 +    87 GTGTTTGGTATTGGGTTATGGTAGGGGGTTTTATATTGATAATTGTTGTGATGAAATTGATGGTTTTTAAGATAGAGGAGATACT
   6.436 +q 75                    .CB?CA==A=BCBCABAAA9BBBB;@B?B@B@7@.CA9AACBB==.B;A?CC=,ABB@9;B7<@;;BA>A*BC/CCCC=C,*A--
   6.437 +s chrM 10123 85 - 16571 GCGTTTGGTATTGGGTTATGGCAGGGGGTTTTATATTGATAATTGTTGTGATGAAATTGATGGCCCCTAAGATAGAGGAGACACC
   6.438 +p                       &).159>CGLOSY^bbcedffdfggggfcbbcedeccffdffcceccedffdfggfdcffdfecbbbcffed`^YTNHB<60,($
   6.439 +
   6.440 +a score=355 mismap=8.09e-08
   6.441 +s 76      0 87 +    87 TTAATTTATATATTTTTTATGAAAAAATTTTTTATTATTTATTTTAGTATTATTTATATGATATGTTTCTATATTTATTATAATTTT
   6.442 +q 76                   AB@;:B9>=?>->@@<@8@@B@<:4@57'5<>@B>A@:@??@1>A@9>@B@6@>?@?;>A@@?A@4?A;3'4A>@>A1;7@?>??=5
   6.443 +s chrM 4155 87 + 16571 CCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCCTAGCATTACTTATATGATATGTCTCCATACCCATTACAATCTC
   6.444 +p                      $(-259<BEJNSVX[]_addfgggggebaaabbdccdcbcdbbbcefdeccdcbcededffdedebbaaaa^\WTPMHEA=94.*'$
   6.445 +
   6.446 +a score=381 mismap=8.24e-08
   6.447 +s 77      0 87 +    87 TTAATAATTAGGTTGTGGGTGGTTGTGTTGATTTAAATTATGTGTTTTTTGGAAAGTTATGTTAGTGGTAGTAATATAATTATTGGG
   6.448 +q 77                   A<:ABB>>9ACABB=494<7?C9;'=BC@AA*<*@/<@6>>>='>/=;A9078+AA@B36;2:B:?>B<B71=>5+2A=:A+1A;>=
   6.449 +s chrM 5707 87 - 16571 CTAATAATTAGGCTGTGGGTGGTTGTGTTGATTCAAATTATGTGCTTTTTGGAAAGTCATGTCAGTGGTAGTAATATAATTGTTGGG
   6.450 +p                      $(.37<AEINTY\^bcfgfdffccdcecceebbbeffccedecdbbaabcfggggfccedeccffdffdda\YTNJEA<63//.-*&
   6.451 +
   6.452 +a score=329 mismap=8.94e-08
   6.453 +s 78       0 85 +    87 TTTTTTGTGTTAGTAATTATGTTTTGTTGATTAAATATTATTCTTTTATTTATAGGATTTAATATATTAGTTATAGTTTTATATT
   6.454 +q 78                    B@BCC*B>BBBBBB>A>B<BAA<<A4AA@BA;5?ABA@?09?(9>?<@B;:'8::0479>@?(9/;99@??B<:>A777>=::>9
   6.455 +s chrM 11894 85 + 16571 CTCTCTGTGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGCCCTATACT
   6.456 +p                       #&)-038<ADHNSW\`abca`\YVSPSW\`abegfdeccdba`aaabdbbbddfggfccceecedeccda\YVQNHC?;850-($
   6.457 +
   6.458 +a score=369 mismap=9.6e-08
   6.459 +s 79       0 87 +    87 ATTTGAATTAATATAATTATTTATAGTTTAATTATTAGTATTATTTTTTTATTATTTTTTAATTAAATTAATAATAATTTATTTAGT
   6.460 +q 79                    BCC?BCBBBACB?B:B>4B:9B>A<@@B@BBBA=B?9@AB@AA9BA9?@@A14=BB@>B>@B8@@?@:4:0=<A>@<A>><85:;22
   6.461 +s chrM 10826 87 + 16571 ATTTGAATCAACACAACCACCCACAGCCTAATTATTAGCATCATCCCCCTACTATTTTTTAACCAAATCAACAACAACCTATTTAGC
   6.462 +p                       %),06;@DHMRV[^bdccdcbcedffcbcefcceccffdeccdbbaaabbdccdbbaabcefccfgfcceeba\WSNHDA>952/*$
   6.463 +
   6.464 +a score=368 mismap=8.66e-08
   6.465 +s 8       0 87 +    87 AGTATATTCTTTAATTATTTATATAGGATGAATAATAGTAGTTTTATCGTATAATTTTAATATATCTATTTTTAATTTAATTATTTA
   6.466 +q 8                    B@C=BBCCBC?CCCC>BCC<B;@B@@BA2>C:<ABCC<A@A=@BB-@B?:B<B7>?AB:A@@@>(:AB@=B;B@BB>@<@>@A@ABB
   6.467 +s chrM 5006 87 + 16571 AGCATACTCCTCAATTACCCACATAGGATGAATAATAGCAGTTCTACCGTACAACCCTAACATAACCATTCTTAATTTAACTATTTA
   6.468 +p                      &+/48=@CFILPUY\^`aabddedfggfdfgfdffdffdffcbbcdccededfecbbcefddb`\^`ba``^]ZVPMIFA<84/,(%
   6.469 +
   6.470 +a score=359 mismap=9.42e-08
   6.471 +s 81      0 87 +    87 TTATAGTGAAATGTTTTAATTAAATATTATCGTATGGTTTATTATAATTATTTTTATATTTTTTATATTATTTTTTATTATTTAATT
   6.472 +q 81                   @C<?BCCBCCB@CB@;BB=4@@>BCAAB@.0;B@@?C@BBA3>AC>8/B=A=C@B<C226A1>8B@B;A<98AB>>)>A?<@@8@<5
   6.473 +s chrM 8356 87 + 16571 TTACAGTGAAATGCCCCAACTAAATACTACCGTATGGCCCACCATAATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACT
   6.474 +p                      $(-17<@FLQVZ^_`abefccfgfdecceccededffcbcdccedffccdbbbbbecebbaabbecebba]ZXUROLHDA<952-($
   6.475 +
   6.476 +a score=422 mismap=7.99e-08
   6.477 +s 82      0 87 +    87 AAAAATGTTGAGTCGTAGATGTCGTTGGAAATGGTGAAGGGAGATTCGAAGTATTTTGAGGTTTGTAGGAGGGTAATATAGAGATTT
   6.478 +q 82                   @BCAB5BCBCBC?CBCBBAA<BAB@4'AC@ABCCBCCBACBA@B@BCB7<@3A8B?@+>AB:(=74@4'5B@BBB9%:BB39<9<75
   6.479 +s chrM 6771 87 - 16571 AAAAATGTTGAGCCGTAGATGCCGTCGGAAATGGTGAAGGGAGACTCGAAGTACTCTGAGGCTTGTAGGAGGGTAAAATAGAGACCC
   6.480 +p                      &,28=AFIMSY]_addfgfdecceccegggfdffdfgggggggfcccfggfdecbbcfggfcabedfgfggfc^[VQOKGB=71+'$
   6.481 +
   6.482 +a score=332 mismap=9.82e-08
   6.483 +s 83       0 87 +    87 TTATAATTTTTTATTTTTTTTTTGTGGTATTATATTTATTGCGTTAGGTTTCAATTTTTATTGTTTATATTTTGTTTGGGTAAATGG
   6.484 +q 83                    BBB8BABA@BB@A?BB?C@@<BBBB;B<B@@8?AB<B@AB?@A?B?AB?AA@96<B@9AAAB:B@<A;9@:9A6@6-=8=5>@??4B
   6.485 +s chrM 14758 87 - 16571 TTATAATTTTTCATCTTTCCCTTGCGGTACTATATCTATTGCGCCAGGTTTCAATTTCTATCGCCTATACTTTATTTGGGTAAATGG
   6.486 +p                       $(-16;>ADGJNSVX[]^``aabedffdeccedecbcdccedeccfgfcbbceecbbbbdccdbbbb_]XTQNKLMMMLID@;5/,&
   6.487 +
   6.488 +a score=309 mismap=9.21e-08
   6.489 +s 85       0 86 +    87 AATTATAATAAGTTTTATTTGTTTATGATAAATAGATTAAAAATCGTTTATTGTATATTTTTTAATTGGTGATATAGGTCTCGTTG
   6.490 +q 85                    ;(0(@4<3;<.6-<9?BB1B@@@B<.7@B<=<@@9@AB61?:<B@@=98ABA>?A+B8><A+>=?9((A9-2A19,'(@-697@##
   6.491 +s chrM 11566 86 + 16571 AATTATAACAAGCTCCATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCATACTCTTCAATCAGCCACATAGCCCTCGTAG
   6.492 +p                       &*-069?EHNTX[]_acbbbdcbcedffdfgfddb]WTPV\acbcdcbcdccededdba`_^\ZUPLIHGEEDCA>:5431/-(%#
   6.493 +
   6.494 +a score=357 mismap=8.62e-08
   6.495 +s 86      0 85 +    87 GAGAGGGTTTTTGTTAGGGGTTATGGGTTGGGTTTTATTATATGATAGGTATGTGATTGGTGGGTTATTATGTGTTGCCGCGCAT
   6.496 +q 86                   ,A;B<1@?BC>48C@B?C9BB.<?BC=:CB=BBC=BAB*):C>=='<CBBCC?A+BB==B<@6>B:7+7@B7BBC@C########
   6.497 +s chrM 7296 85 - 16571 GAGAGGGCCCCTGTTAGGGGTCATGGGCTGGGTTTTACTATATGATAGGCATGTGATTGGTGGGTCATTATGTGTTGTCGTGCAG
   6.498 +p                      &,28>DHKORUX]_aegggfccedfgfdcfgfcbbbdbbccedffcfgfdededffccffdfeb^[XSOLGC>:51.)'&%$#"!
   6.499 +
   6.500 +a score=366 mismap=8.48e-08
   6.501 +s 87       0 87 +    87 ATATTTTTTATTTGTTTTTTTTTATATATCGGGCGAGGTTTATATTATGGATTATTTTTTTATTTAGAAATTTGAAATATCGGTATT
   6.502 +q 87                    BACC@=BBBC<C=C@BBA@C=AB@BB=?@BB?BBBBABACAA4A?BBB?AAB?;9?BAB79A7ABBABBABBBBBB?BBBBBBCABC
   6.503 +s chrM 15011 87 + 16571 ATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATT
   6.504 +p                       &).147:=AFILPUWZ\^_`aabededeccfgfdfggfcbcedeccedfgfccdbbaaabbdcbcfgggfcba`]WRLHB?;61-($
   6.505 +
   6.506 +a score=354 mismap=8.02e-08
   6.507 +s 88     0 87 +    87 AGTGAGTTTATTTTTTAAATTATTATGATTAAAAGGGACAAGTATTAAGTACGTAATAATGTAGTTTAAAACCTTTAGTTTAGTTAT
   6.508 +q 88                  BCCACCCBCCCCBCACB@CCBBCBC>BBAB@CBBBBBBBCCB>BCBB?AABBBBB??B@BCABBAB@BABBBBBBB>BAABBBB@@?
   6.509 +s chrM 715 87 + 16571 AGTGAGTTCACCCTCTAAATCACCACGATCAAAAGGGACAAGCATCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCAC
   6.510 +p                     &,/5;@CFJNQTWZ]_dffcceccedffcdfgggggggdfgfdeccfgfcb_\WSNRX]_cceeba`_[VPJFGGGGFC@>;60-)$
   6.511 +
   6.512 +a score=358 mismap=8.32e-08
   6.513 +s 89      0 87 +    87 TTTTATATTTTTTATATTATTTTTTATTATTTAATTAAAAATATTAAATATAAATTATTATTTATTTTTTTTATTAAAGTTTATAAA
   6.514 +q 89                   9B:):<CCCAC>C:CCAC==B?CCCCCCCCB@BBCBCB<CBCCCB9?<B6BBA;B>CCC@C@<74C=CA/(;8@;-<3B@C=)%51C
   6.515 +s chrM 8407 87 + 16571 CCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACAAACTACCACCTACCTCCCTCACCAAAGCCCATAAA
   6.516 +p                      $'*-26:=@CGJNSV[]`bbaaabbdccdcbcefccfgggfdeccfgfdfdfgfcceccdcbcdbbaaa```a]ZXSMGA=:730,&
   6.517 +
   6.518 +a score=375 mismap=9.32e-08
   6.519 +s 9       0 87 +    87 TGAATTTACGAGTATATCGATTACGGTGGATTAATTTTTAATTTTTATATATTTTTTTTATTATTTTTAGAATTAGGTGATTTGCGA
   6.520 +q 9                    B=9=B+BBBB>BBB=:BB@;<@@B:<A4@?A:?=BABAAAA>>@<A>@AA>@@@?@@6878:6588?<:>=?9<::=<51<99>;48
   6.521 +s chrM 7901 87 + 16571 TGAACCTACGAGTACACCGACTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAGAACCAGGCGACCTGCGA
   6.522 +p                      $*058;?DHNTY\`bdccffccedffdfgfccfecbbbceecbbbcededebbaaaabbdccdbbbbcfggea_]YSMID>:74/+&
   6.523 +
   6.524 +a score=278 mismap=1.03e-07
   6.525 +s 90       0 66 +    87 GTTAAGTTAAGTTGAAATTTTTTAAGTGTAAGTTGGGTGTTTTGTGTTAAGTTATATTTTGGTTAG
   6.526 +q 90                    8;'6=ABA;1BA.789AA9A>'))4BA??7)?=:(?<1)3@AA>6<@:'.B@?-?:=328124:##
   6.527 +s chrM 14907 66 - 16571 GTCAAGTTAAGTTGAAATCTCCTAAGTGTAAGTTGGGTGCTTTGTGTTAAGCTACACTCTGGTTCG
   6.528 +p                       %(,27<@DJOTW[`dfecbaa`adffdedfffcceffddbbbcedecbca]WTPKHC?<851+'$"
   6.529 +
   6.530 +a score=421 mismap=8.05e-08
   6.531 +s 91       0 87 +    87 AATTAGAGGTGTTTTTGTGTTGTGACAAGGGTGGAGAGGTTAAAGGAGTTACTTATTAGTAATGTTGATAGTAGAATGATGGTTAGG
   6.532 +q 91                    -67A@6@>7@4:BABBB==B@BBB@(@59A@BAA@B9>B??32B<A<B=;:3??B:@A;?BA@>='0A@;B>A??A7:5@@@@A@?>
   6.533 +s chrM 12743 87 - 16571 AATCAGAGGTGTTCTTGTGTTGTGATAAGGGTGGAGAGGTTAAAGGAGCCACTTATTAGTAATGTTGATAGTAGAATGATGGCTAGG
   6.534 +p                       &+/28>DJOSWZ\^`adceccedffcfggggeggggggfddfgggggfccdcbcdccffdffdecbefdffdfda\VRMGC>841,&
   6.535 +
   6.536 +a score=360 mismap=8.36e-08
   6.537 +s 92      0 83 +    87 CGTCGATCGTTGATTATTTTTTATAAATTATAAAGATATTGGAATATTATATTTATTATTCGGTGTATGAGTTGGAGTTTTAG
   6.538 +q 92                   BB@BBC@CA=@>C<BBB<,B@8@@@>A?B:)=BBBCB3'>A@AAB94;A>B@C@=;)+8BA@B:=1C>1B6C7C=<<%.<6<#
   6.539 +s chrM 5909 83 + 16571 CGCCGACCGTTGACTATTCTCTACAAACCACAAAGACATTGGAACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAG
   6.540 +p                      $)-06;>BGJNTY[^aaaaabbedfgfccecfgggfdebcfggfdeccedecbcdbbdcbcffdeddba]XRNJF@:41.+($
   6.541 +
   6.542 +a score=222 mismap=8.25e-08
   6.543 +s 93       0 85 +    87 AGTAATTAGAGGTGTTTATGTGTTGTGATAAGGGTGGAGAGGTTAAAAGGAACGTTCCTGATAAGGTGGGCGATCTGGCTGTCCC
   6.544 +q 93                    B;/;B=B@AABA*931:)(6B>=?<1/?;6::5,;;78:88790+7:######################################
   6.545 +s chrM 12740 85 - 16571 AGTAATCAGAGGTGTTCTTGTGTTGTGATAAGGGTGGAGAGGTTAAAGGAGCCACTTATTAGTAATGTTGATAGTAGAATGATGG
   6.546 +p                       &+/5:=AGMSX]^`^\ZWZ_acccedffdfgggfdfeb]WQKEA>93-+)('''&&&&&&%%%%%%%$$$$$$$#####"""!!!
   6.547 +
   6.548 +a score=326 mismap=8.05e-08
   6.549 +s 94       0 87 +    87 TTTATTATATTAATAATATAAAATTTTTATTTATACGAGAAAATATTTTTATGTTTATGTATTTATTTTTTATTTTTTTTTGATTTT
   6.550 +q 94                    @=@@7B;B?@A:ABB@?AC7;A;@;@B@@@8B;AB9?>B?;4@@;>66:A=>@<B7/8'49>@1*:4=;;@:,39:859?8163,3:
   6.551 +s chrM 12018 87 + 16571 CCCACCACATTAACAACATAAAACCCTCATTCACACGAGAAAACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTATCCC
   6.552 +p                       $'+037<@DHLQWZ_ccedfggfcbbbbdcbcededfgggggfdecbbbbecebbaa]Z]``_^]YVSPMJGC?<9630-*'&&%$#
   6.553 +
   6.554 +a score=279 mismap=9.95e-08
   6.555 +s 95     0 74 +    87 TTTTGATTTTTGTCTTATTTTATTATTTATCGTATTTACGTTTAATATTATAGGTGAATATATTTATTGAAGAG
   6.556 +q 95                  B@BABA>BB=.=?*@@?2<A?6BA=*?@>>8:?0;=6>@A8?76@7<?@?;99174=9?3216;(:19######
   6.557 +s chrM 131 74 + 16571 CTTTGATTCCTGCCTCATTCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACCTACTAAAGTG
   6.558 +p                     $'*.48;>AEHMPRUY]_`abdccdbbbdccedecbcedecbcffdeccedfgeba\WQMHD?;850-*(&%#"
   6.559 +
   6.560 +a score=378 mismap=8.36e-08
   6.561 +s 96      0 87 +    87 ATAAATATTATTATAATAAATATTTTTATTATTATAATTTTTTTAGGAATAATATATGACGTATTTTTTTTTGAATTTTATATAATA
   6.562 +q 96                   BBBA=7<A@@?@ABBB?A:A<@?@<??<;?@??=;:?:<<>>@999987;@???????95=<<<;:999:7954::9:537<:::88
   6.563 +s chrM 3991 87 + 16571 ACAAACATTATTATAATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACTCTACACAACA
   6.564 +p                      &*05:>CFJORV[^cedfgfdecbbbbdcceccedfecbaaabcfgggfdffdededffdedebbaaaaaaaa^YSOLIFA=85/*&
   6.565 +
   6.566 +a score=257 mismap=8.77e-08
   6.567 +s 97     0 86 +    87 TTTTTTACAGTTTATGTAGTTTATTTTTTTAAAGTAATATATTGAAAATGTTTAGACGCTTTGACCGAGGAGAACCCTTAATTACT
   6.568 +q 97                  ACB8ABBCBBBABCC=BB=BAB=24=+@@@A@1>@-@@BBAC,B>A8?B94<37BAA>############################
   6.569 +s chrM 569 86 + 16571 CCCCCCACAGTTTATGTAGCTTACCTCCTCAAAGCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATAAACAAATAGG
   6.570 +p                     $'*-049=CGKNRWZ_adecbcdbbaaabcfggfdffdedeccfgfd`ZWQNJGB=73.+)(''&%%%$$$$$$#######"""!!
   6.571 +
   6.572 +a score=230 mismap=9.87e-08
   6.573 +s 98      0 84 +    87 CGTGTAGTACGATGTTTAGTGATGAGTTTGTTAATATAGTGTTAGTTAGGTTATGCATTCCGATCATACAGGTCAGTGTAAGTG
   6.574 +q 98                   9BBBA6=?8*<(;BAB@7B+AA<<A<)504)/A:A1*<+8B=+A;17A/A##################################
   6.575 +s chrM 9562 84 - 16571 CGTGTAGTACGATGTCTAGTGATGAGTTTGCTAATACAATGCCAGTCAGGCCACCTACGGTGAAAAGAAAGATGAATCCTAGGG
   6.576 +p                      $)-26<AEJMSWZ^`abefdffdfgebbbdbceecb^\X[^^][WQNJE@:8755443322110/.-,+*)'&&%$###""""!
   6.577 +
   6.578 +a score=284 mismap=9.33e-08
   6.579 +s 99      0 87 +    87 TTGTAATAATATTATCGGTTAGGCGTACGGTTAGGGTTATTGTTTGAATGAGTAGGTTGATGGTTTTGATAATAAACTATTTGGCGT
   6.580 +q 99                   :C@+8';24=+C>B=B8>(>?*>A93B*B+2;((>*BB.,*B*BBC>+)@B>>:?5B>.*&%;'='/=1?77416############
   6.581 +s chrM 7545 87 - 16571 CTGCAGTAATGTTAGCGGTTAGGCGTACGGCCAGGGCTATTGGTTGAATGAGTAGGCTGATGGTTTCGATAATAACTAGTATGGGGA
   6.582 +p                      $'+-//244555666:?DGKPUZ]abdcefcceffeccca_^Z\_cffcfgfdfgfccecaa`]ZXUSNIE@:61+)('&&%%$##"
   6.583 +
   6.584 +
   6.585 +TEST maf-swap -n1 90089.maf
   6.586 +a score=3061 mismap=1e-10 sense=6.5 don=GC
   6.587 +s chrX  23075589 648 + 156040895 GCCGGGGGA-GTCCGAGAGGAAGCGGAGGCGCGAGCTGGAGGCGGCGGCTCCCGTCGGCCTCCGGCAGGACTGAGCG-----CTGGGAAGCCGGAAGGCGGGCGCGCACGGCGGAGA-GGCGGGCGGGAGGCCGGAGCATATTAATGAAAAGTGCCATAAACTGAAAAACCAAACATGAGGGTAGCAGGTGCTGCAAAGTTGGTGGTAGCTGTGGCAGTGTTTTTACTGACATTTTATGTTATTTCTCAAGTATTTGAAATAAAAATGGATGCAAGTTTAGGAAATCTATTTGCAAGATCAGCATTGGACACAGCTGCACGTTCTACAAAGCCTCCCAGATATAAGTGTGGGATCTCAAAAGCTTGCCCTGAGAAGCATTTTGC-TTTTAAAATGGCAAGTGGAGCAGCCAACGTGGTGGGACCCAAAATCTGCCTGGAAGATAATGTTTTAATGAGTGGTGTTAAGAATAATGTTGGAAGAGGGATCAATGTTGCCTTGGCAAATGGAAAAACAGGAGAAGTATTAGACACTAAATATTTTGACATGTGGGGAGGAGATGTGGCACCATTTATTGAGTTTCTGAAGGCCATACAAGATGGAACAATAGTTTTAATGGGAACATACGATGATGGAGCAACCAAACTCAATGATGAG
   6.588 +s 90089       48 622 +      2478 GCCGGAGGAAGTCCGAGAGGAAGCGGAGGCGCGAGCTAGAG-CAGCGGCTCCCGTCGGCCTCCGGCAG-------CGTTAAACTAGGAGGCCGGAAGGCAGGCGCGCACGGCGGAGAAGGCGGGCGG-AGGC--GAACATATTAATGAAAAGTGCCATAAACTGAAAAACCAAACAT-AGGGTAG---GTGCTGCAAAGTTGGTGGTAGCTGTGGCAGTGTTTTTACTGACATTTTATGTTATT-CTCAAGTATT-GAAATAAAA-TGGATGCAAGTTT---AAATCTATTTGCAAGATCAGCATTGGACACAGCTGCACGTTCTACAAAGCCTCCCAGATATAAGTGTGGGATCTCAAAAGCTTGCCCTGA--AGCATTTTGCTTTTTAAAATGGCAAGTGGAGCAGCCAACGTGGTGGGACCC-AAATCTGCCTGGAAGATAATGTTTTAATGAGTGGTGTTAAGAATAATGTT-GAAGA-GGATCAATGTTGCCTTGGCAAATGGAAAAACAGGAGAAGTATTAGACACTAAATATTTTGACATGTGG---GGAGATGTGGCACCATTTATTGAGTTTCTGAAGGCCATACAAGATGGAACAATAGTTTTAATGGG---GT--GATGATGGAGCAACCAAACTCAATGATGAG
   6.589 +p                                &(((($$$""4>DHMOPPMNNNRRNNRNNQPQQRQPJ452##779;<>AQLJLRRRNNNNRNKA=4&#++)+,%#)).,-+)*,-0687<JMNNNNMJH<>AOOOPPRRNNRI=:4$#25EEED?%""7?>++**--DJQQNNNNRRJHHJRRRNNRRLJLRRRIGGGINNLJLQJ<22=?86%"6%"4KORRRRLJLRNNNNRNNRRRRRQQNNRRQQQIGGGIRRRRRRRJHHJRQRLG@%""9DHNNQH@%""AIIGB'$#!!CMNRRRRNNQB?;GL=~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~20.?PQJHHHI:!!#$':;=@RNNRNNRRNNRRRRRNNNNRRRNNRLJLRB?>""$'BOPRNNRNNNNRQRNNRRJHHJNNRRRQRNNQQNNNNRNNRNNOM?<##25@7""%7NRNNRRNNRNNNNNNRLJLRNNIGGGIRRNNQQNNRRRNNRRQQQRRLJLQQJHHJRRRRNLI1.!#%"#%'3KNQNNRRNNRLJLRNNRRRLJLRRRNNNNNNRRRRNNRRRNNNNRNNRRRJHHJNNK41/$/5"&*'09ACEFHMRRRNNNNLJLRRRNNQPNF=6)
   6.590 +p                                ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~f~~~~~~~~~~~~~~~~~~~~~~~~~~9999999~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~p~~~~ii~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~p~~~~~~~III~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~p~~~~~~~~~~p~~~~~~~~~m~~~~~~~~~~~~~ddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ii~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~p~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~p~~~~~U~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddd~~zw\\[[[[[[[ZZZZZZZZZZYXXXXXXXXXTTTTTTTTTTSSSSSSSSSSSSSSSSSSSSSSRRRRRRRRRRRRRRRRRRRRRRQL.............
   6.591 +
   6.592 +a score=493 mismap=0.014 sense=6.5 acc=GC don=GT
   6.593 +s chr7  121351142 114 + 159345973 CTGTTCAAAAGGGCTTTTTGTCTTAATGCCCTTCCCACCACAGAAGACCCAGTTGTCTCTAAAACCAAGATTAGTAATAGATGTGCTCCCCAAATCAGCAATGAGCCGCCGTGC
   6.594 +s 90089      1702 101 -      2478 CTGTTCAAA-GGGCTTTTTA--TTAATGCCCTTCCCACCACAGAAGACCCAGTTGTCTCTAAA-CC-AGATTAGTAATAGATGTGCT-CCCAAATCAGCAATGAGCC-------
   6.595 +p                                 &,1578&$""57:J9643*'*'~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~1..#$7ENNRRRNNRRRRRQQQG8""$'>?BRRRRRNNOIC,)$''()%+$
   6.596 +p                                 3333333310000,,,,,,,,,,,,,,,,,))))))))((('''''''&&&&&&&&%%%%%%%%%$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$
   6.597 +
   6.598 +a score=9115 mismap=8.94e-10 sense=6.5 acc=AG
   6.599 +s chr7  121348853 1697 + 159345973 ACAAAGCAAAACCAAGAGTATTTATTTTCATTATTTTAAAAAACTGCAACATTTATTTCACAATCCCTGGAACTGTAAAATAACTATTCTTTTAATTTACAGAATTGAGGGAAGTATTTTAAATGTCAAAATACACATGCTGAATGTGATTTAGCATATAAGCACCAAAAATCCCAAAAGTATACAAA-GATTGTTTAAACATATAAGGTGCATTTATTCatgaattaattaCATTCAGTTTGAAGGAAGAAACAGTACTCCAAAGTTCATCAATATTTAAGAAATTATCCGAATAGCTTCCAACTTGGTTTACAGCTAAATAACAGATACTGCTTTTAGGTTTTTTTATACAATGCATCTAAACTTTAGGTTCGAAATTTAAGTGCTGCCTTACACTGTGAATGGCAGTTTGATCACTAAATTTATGTTCCAGTTTGAGATACTTCATACACAACATATATTTAATGCCCTGAAAACTTCTGCTTAAAAACTGAGTTATTTAGTGAACATCTGAAGGTAACAAAAAAAGATAGATCTTCTATATTTTTATGTAGAATTGGGTATAAAGTCATTTGGGGTCAAACACAATTATTTTTTAAATGTTATCAGTCCGCCCAGTAATAAGAACTTTTGTAAATATGCCACTATAGCTTCGGGCAATAATTGCTATTATGAAGTTAGATAAACACAGGATTAATTTCTTGGTTTACAAATCAAAATTATTGTGATATTAAAGCATGCCTCCTTCCAAACCACTTGGTCAATGCTGATAACAATTAAGAAAAACGTATGCTAGTATTGCTCTAAATATACTGACTTAGCTGTCCTGAATGACCTAATTAGGTTGGGGAGGGGACTTGGCCTGGTTCTCCAGTTCTGTGAAGCTGCCACCTCCAGCCTCACTCTAAATAGCTTATACAAAATCAAGTTATTCCCATAGCTAACACAAATCCAGCAAGCTGTGGTCCTAAATGCCATCTACATTTAtatatttacttttttactgTGTACATTAAGAATTTTGTTGTGCTTTTCACATATCCGATGTATGTTTTCATATTAAACATTCCTCAGTTTCTTGGGAAGGAAAGAAAAAGATCATGAAAAGAGGTACATCAGGAGAGTCGGACTGTAAAGTAACATTACACACACAACTAGCCAAATCTCTTTTTAATTTAAAAGATAATGTCATCACAACGCAACATATAgaaacataaaagaaaataaaGTATCCACCCTAAAATCCCTATTATTCCATGATATTTTCATAGCAACTAGTATatatatcaatatatttttCACAAACCATTCAGTTACACATTGTGTATGCTTTTAGAATTTAAAATATGTATTACCATAGCAGTCTAAACATTGTACTTTTAGGGAAATGTGCGGAGACATGGTTCAGTGATTTGATCATTGTGATGATTATTTACAATGCTATCTATTTACGTTAGCAATAAATAATCCTGATATCAAAAGAGACAATACTCATGCACACACCAAGATGGCTGCATGCTCTTAAAATATTTACACATAGCTCTGCCATTTatagctctcccattaagaGTGAAAGTGCGCTTTCTTCAATTCTC-TCCACATTTCCATTAGTCTTGCTTCTGGGGGATGCATCCTTCCATTTCTACAACTTCAGGCCATCCTTCATATTTGTTTGTATCCTTATTGTTCTTTATGTG
   6.600 +s 90089        47 1655 -      2478 ACAAAGCAAAACCAAGAGTATTTATTTTCATTATTTTAAAAAGCC-CAACATTTATTTCA--ATCC-TGGAACTGTAAAATAACTATTCTTTTAATTTACAGAATTGAGG-AAGTATTTTAA-TGTCAAAATACACATGCTGAATGTGATTTAGCATATAAGCACCAAAAATCCCAAAAGTATACAAAAGATTGTTTAAACATATAAGGTGCATTTATTCATGAAT-AATTACATTCAGTTTGAAGGAAGAAACAGTACTCCAAAGTTCATCAATATTTAAGAAATTATCCGAATAGCTTCCAACTTGGTTTACAGCTAAATAACAGATACTGCTTTTAGG--TTTTTATACAATGCATCTAAACTTTAGGTTCGAAATTTAAGTGCTGCCTTACACTGTGAATGGCAGTTTGATCACTAAATTTATGTTCCAGTTTGAGATACTTCATACACAACATATATTTAATGCCCTGAAAACTTCTGCTTAAAAACTGAGTTATTTAGTGAACATCTGAAGGTAACAAAAA--GATAGATCTTCTATA-TTTTATGTAGAATTGGGTATAAAGTCATTTGGGGTCAAACACAATTA-TTTTTAAATGTTATCAGTCCGCCCAGTAATAAGAACTTTTGTAAATATGCCACTATAGCTTCGGGCAATAATTGC---TATGAAGTTAGATAAACACAGGATTAATTTCTTGGTTTACAAATCAAAATTATTGTGATATTAAAGCATGCCTCCTTCCAAACCACTTGGTCAATGCTGATAACAATTAAGAAAAACGTA---TAGTATTGCTCTAAATATACTGACTTAGCTGTCCTGAATGACCTAATTAGGTT--GGA-GGGACTTGGCCTGGTTCTCCAGTTC--TGAAGCTGCCACCTCCAGCCTCACTCTAAATAGCTTATACAAAATCAAATTATTCCCATAGTTAACACAAATCCAGCAAGCTGTGGTCCTAAATGCCATCTACATTTATATATTTAC-TTTTTACTGTGTACATTAAGAATTTTGTTGTGCTTTTCACATATCCGATGTATGTTTTCATATTAAACATTCCTCAGTTTCTTGGGAAGGAAAG-AAAAGATCATGAAAAGAGGTACATCAGGAGAGTCGGACTGTAAAGTAACATT--ACACACAACTAGCCAAATCTCTTTTTAATTTAAAAGATAATGTCATCACAACGCAACATatagaaacat-aaagaaaATAAAGTATCCA-CCTAAAATCCCTATTATTCCATGATATTTTCATAGCAACTAGTATatatatcaatatatttttCACAAACCATTCAGTTACACATTGTGTATGC-TTTAGAATTTAAAATATGTATTACCATAGCAGTTCAAACATTGTACTTTTA-GGAAATGT--GGAGACATGGTTCAGTGATTTGATCATTGTGATGATTATTTACAATGCTATCTATTTACGTTAGCAATAAATAATCCTGATATC-AAAGAGACAATACTCATGCACACACCAAGATGGCTGCATG-TTTT-AAATATTTACACATAGCTCTGCCATTTatagctctcccattaagaG-G-AAGTGCGC-TTCTTCAATTCTCTTCCACATTTCCATTAGTCTTGCTTCT-GGGGATGCATCCTTCCATTTCT---GCTTCAGGCCATCCTTCATATTTGTTTGTATCCTTATTGTTCTTTATGTG
   6.601 +p                                  ',28=DJIHHJNNNNQQRRRLJLRJHHJRRNNRIGGG520/.''%&*=BIOLJLQC@=%"%"36%""7KMNNRRRRJHHJRNNRRRNNQJHHJNNLJLRRRRNNNNG9%""69KRQA><;%""ANPRJHHJRQQPQQRRRRRNNRQQRRLJLRRRQQPQNNRRRNNIGGGIRLJLJHHJROML@=&$""9@MNRLJLLJLRQQPQNNNNRRRRLJLRNNRRRO?<$#<?LMQRRNNRRRLJLRNNNNNNQLJLRRRRRRRNNLJLRNNRRRRNNQQLJLNNRLJLNNRRNNRNNRRRRNNNNNNRNNNNLJLRRRRRRLJLRNNRRRRRRRRRRJHHJPB;I=~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~1414KMQRRRNNRJGEA!!#$'BIQRRRNNNNLJLRQQLJLRRRRLJLJHHJRRLJLPPPNMLIC!!"$%(?ADRRNNRRRRRRNNRLJLRRRNNRNNRNNRJHHJRRLJLQQRRNNRRRQQRRRNNRLJLRNNRNNNJI9"$&"$&?CLRNNRRRRLJLPPQQNNRNNNNLJLQNNNNLJLRRLJLRRJHHJNNRNNQQRRQQNNLJLRRRRRNNQNNNNNNLJLNNRRNNNNRRNNRRRRRRRNNRNNNNNNQIGGGIRPD=#7?#7FLONNRRQQRLJLPPQQRRRRRNNRRRRRRNNRRNNRRRNNRNNNNRMLF?"%"$+""$':PNNNNNNRNNNNQQNNRRK@="%"%?DQRRRNNRNNRNNRRNNRQRQQQRLJLRRRRNNQQQRJHHJRQ?<:HKOMMLJLRQPK>AMMPPPLJLRNNRRRNNRRRQQNNRNNRLJLRRNNRRRRRRRLJKOOOOOKJKO;!!"$%(DPPQPQQRRRNNNNRNNJHHJRNNQQRRJHHJQQQQQQQNNRRRRRRRRJHHJRRQQNNLJLRRNNNNRRRRLJLQNNLJLNNNNJGF;!!#$';HRRRRRJHHJQQNNRRRRRRRNNPPPQRRNNRRRRRLJLRRNNRQG;!"!"#$%&)8IRRRNNLJLQPPPIGGGINNLJLJHHJRQRNNRRRRRRQQQNNRRRNNRQQPQQRLJLQIB""#&:DEFIRLJLRRRRLG@""%7HGHJRLJLRRNNRNNNNRRRQQQJHHJRRRRRRNNRRRRPONMMMNOPRNMPOOPIGGGIQQQLJLNNRNNRRRNNQQPQQNNQPQQRPN9""$'BNMNLJLJHHJQQQRRRNNRNNRRRRQOF.**>ADQRNNRRRRJHHI9""%468521#0$2EKMRRRNNNNRRRRRRLJLRRRRRNNQQQRRRRNNRLJLRRNNRRRRRRRQRLJLRRRNNRRRNNRLJLRNNRNNRRQQPNB""#&:DFIRNNRRRRRRRRQOOOOOMNNNRRRNNRRRRQH?###++""$'AFHJLQQPQQRRRRQQRRNNRLJLQQRRQPPPKJLRNNMFB?+3("#&:MNNL8""%8CGONNJ=:83##25IKMLJLNNRNNRRRRNNRRNMNB!!#$';OQRRRNNNNNNRLJI@;"%4"%>CPRNNNNRRNNNNRRQQLJLRLJLRRRRNNNNRNNRNNQLJKKF@:5
   6.602 +p                                  zz{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{o{{{{{{{{{{{{{{ii{{{{U{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{p{{{{{{{{{{{p{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{p{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{ii{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{ii{{{{{{{{{{{{{{{m{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{m{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{aaa{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{ZZZ{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{{zzziizzzhzzzzzzzzzzzzzzzzzzzzzzzzziizzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzozzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzozzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzNNzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzvvvvvvvvvvvvvvvvvnttttoooooooolkkkkkkUbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb`_\\\[[[YXXXXXXXXXXXXXXXXXXXXXXXXXXXXWWWWWWVVVVVVVUUUUUTTTTTTTTTTTTTTTTTTTTTTTTSSSSSSSSSSSSSSSRRRRRRRRRRRRRRRRRRRKLKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKJJJJJJJJJJJEFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEEEEEE??>>>>>>>>>>>=<;;;;;:::::9999999999999999999998888888888877777777777777777777777777777777766666666664444444444444444444444444333333333333333333
   6.603 +
   6.604 +
   6.605 +TEST maf-swap -n3 ../examples/multiMito.maf
   6.606 +a
   6.607 +s chickenMito 1246 353 + 16775 CAAAGCATGGCACTGAAGATGCCAAGATGGTACCTACTATA-CCTGTGGGCAAA-AGACTTAGTCCTAACCTTTCTATTGGTTTTTGCTAGACATATACATGCAAGTATCCGCATCCCAGTGAAAATGCCCCCAAACCTTTCTTCCCAAGCAAAAGGAGCAGGT-ATCAGGCACACTCAGCAGTAGCCCAAGACGCCTTGCTTAAGCCACACCCCCACGGGTACTCAGCAGTAATTAACCTTAAGCAATAAGTGTAAACTTGACTTAGCCATAGCAACCC-AGGGTTGGTAAATCTTGTGCCAGCCACCGCGGTCATACAAGAAACCCAAATCAATAGCTACCCGGCGTAAAGAGTG
   6.608 +s humanMito    598 349 + 16571 CAAAGCAATACACTGAAAATGTTTAGACGGGCTCACATCAC-CCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAAGCATCCCCGTTCCAGTGAGTTCACCCTCTAAA---TCACCACGATCAAAAGGGACAAGC-ATCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTA-GCCACACCCCCACGGGAAA-CAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTCACACGATTAACCCAAGTCAATAG-AAGCCGGCGTAAAGAGTG
   6.609 +s mouseMito     18 346 + 16299 CAAAGCAAAGCACTGAAAATGCTTAGATGGA-TAATTGTAT-CCCATAAACACAAAGGTTTGGTCCTGGCCTTATAATTAATTAGAGGTAAAATTACACATGCAAACCTCCATAGACCGGTGTAAAATCCCTTAAACAT-TTACTTAAAATTTAAGGAGAGGGT-ATCAAGCACATTAAAAT--AGCTTAAGACACCTTGCCTA-GCCACACCCCCACGGGACT-CAGCAGTGATAAATATTAAGCAATAAACGAAAGTTTGACTAAGTTATACCT--CTTAGGGTTGGTAAATTTCGTGCCAGCCACCGCGGTCATACGATTAACCCAAACTAATTA-TCTTCGGCGTAAAACGTG
   6.610 +s fuguMito      16 350 + 16447 CAAAGCAGAGTACTGAAGATGCTAAGATGGGCCCTGAAAAGTCCCGCAGGCACAAAAGCTTGGTCCTGACTTTACTAACAACTCTGATCAAACTTACACATGCAAGTATCCGCATCCCAGTGAAaatgccccccgcc---ccccgtcCGGAAATAGGGAGTTGGTATCAGGCACACAAATTTGTAGCCCATGACACCTAGCTTT-GCCACGCCCCCAAGGGAATTCAGCAGTGATAAACATTAAGCCATAAGTGAAAACTTGACTTAGTTATGAT--CTAAAGAGTCGGTAAAACTCGTGCCAGCCACCGCGGTTATACGAGAGACCCAAGTTGTTAG-CCAACGGCGTAAAGGGTG
   6.611 +p                              '.37<?ABBCGLPTWXYYYXUMKIC:1'%#"!+-.///045~68;DMRTV\]ZZZ`fhhhikknkjh`a_^XVSSSUYZYUSSRRQRU]a`_chjnnnooole\TKJHHFECBBAAA>8542---,,,,,,,*)($"$"~*+-........./12222222357~9:::96/,%##""""""""/9BIKSVVWXWWVWW`fhno~olknnmgeeegmmhffb_`~ekooooomg_\\\[[\\\_gmkknjhjnnjhimhfecekg^UKB?=<7/%#$"*,/8AHJSX_beabdgginooolloollnlknnllomjejmonjjfd^[ZTRPOOOOOMM~MNOPT\^fhbXROIGE@>
   6.612 +p                              %*/37:;<<=BFIKLLMMMMMMMMMMMLLLKKKKKKKLLNO~TX]bgkosuvwyz~~~~~~~~~~~~~~~{wrmmlllkjggfffffffffeeedb^ZVQLHC>944210.*))))))))))(((((((((((((((((~((((((((((((((((((((((((~)))))))))))))))))))-1355899;<<>>@AFJOTY~]bglquz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}yuqlggeb^YTTSSTTUZ_chmquxz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{wrmhd_ZUQLKKKJJHH~HHHHHHHHGGFDA=<<;:
   6.613 +p                              (())))))))))))))))))))))))))(((((((''''''~'''''''''&%$#)+,-.015<BEIKLQVZ^afgcZWPPMMLLKJJJJHHHJQWYagjnookkjeiic`^_^^]_a_VQH>;:8887776632,$++#,01246<>DFNQUWWVUTTZZZ[^~ef_ULIB?>=<;;;;;;>>HPUUVRPIIG@744432,*##-47@INKHGFEA8/,+%$""/9BLU]bachijjihca_bjnkkib_[ZZUUTTTUVXZ__^_^VMJC:0-,+%#""/579@CJLSUZ\]Z[[~~~~~~~~~~~~~~~~~~~aa`\\[[^`ba`\YWWRJG@7.##()+-47=???><940+'
   6.614 +p                              ''(((((((((((((((((((((((((((((((((((((((~((((((((((((()**+.016:?CFHIMRW[`cefgggggggghhhhhhhhilnosx|~~~~~~zywtplkiiggfda]YTONNNNNNNNNMMMMLLLMMMNOOPQRSX]adfghhhjklmm~oppqppppomlkkjjkkmmqsttvwwwwwvtqqoonlkjglqvz~~~~~~~|xsniedbafkotx{}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{wvvutqninsw|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vutppnnnmljgc^ZYWTPKGB============<:73/*%
   6.615 +p                              '+-///00001479:::::::::::::9988542.+*)('$"''()*,,.45699;=ACHKQUY[[YRQRQRRS[a`]]__fiha^]XXYYXX_bjnnnooookkkejjc`^`^^]^``WNE;87555555555444~~~444433222222111100.'%#"!!2:@BBENWZYZXRQQRU\^fjd`a`]]`b``_bjjb^^^~`\YSJ@><;:953210,*##-7@JS\ejg_\]^]\]\\_fcachb`^^a]ZYXWXXXXTLC@90-+*%#"""*+,.4669@BKRWWYYY[_gmoolloollnlknnjiebfdhifb[YY_ddfijha\[\^^[~TSSTX`cjlkca`ZVUPH
   6.616 +p                              %(+,,-----.02233333333333333333333333333334444455577899:;==BGKOSTUVVVXX[\\^_```bbfghiiiijkllmrw{~~~~~~~|wsnmkhd__]\[[ZXUQLHCBBBBBBBAAAAAA~~~AAAAAAAAAAAAAAAAAAAAAAAAAEIKMMPQQRRRRRRRSVWX[]^^_```cddfgkoqrsuu~z~~~~~~~~~~|xwurniddhmrw{~~~~~~~~~~~~~~~~~~~}yuttsrokjjihgfda`_\[ZWSRRQQRRRSUWWZ\]`bcdeffglquz~~~~~~~~~~~~~~~{{yxwuqmllllkjgc_ZVUTTTT~RRRQQQQQPNKGB>9863
   6.617 +
   6.618 +a
   6.619 +s chickenMito 1702 574 + 16775 ATTTTAACCCACGAAAGCTAGGACCCAAACTGGGATTAGATACCCCACTATGCCTAGCCCTAAATCTAGATACCTCCCAT-CACACATGTATCCGCCTGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATAATCCACGATTCACCCAACCACCCCTTGCCAGCA----CAGCCTACATACCGCCGTCGCCAGCCCACCTCTAATGAAAGAACAACAGTGAGCTCAATAG-CCCCT-CGCTAATAAGACAGGTCAAGGTATAGCCTATGGGGTGG-GAGAAATGGGCTACATTTTCT-AACATAGAACA-AACGAAAAAGGATGTGAAACCCGCCCTTAGAAGGAGGATTTAGCAGTAAAGTGAGATCATACCCCCTAAGCTCACTTTAAGACGGCTCTGAGGCACGTACATACCGCCCGTCACCCTCTTCA--CAAGCCATCAACATCAATAAATATATACTTCCCCTCCCGGCTAAAGACGAGGCAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTACCAAG
   6.620 +s humanMito   1042 564 + 16571 ATCTGAACACACAATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGCCCTAAACCTCAACAGTTAAATC-AACAAAACTGCTCGCCAGAACACTACGAGCCACA--GCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATCCCTCTAGAGGAGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTT----GCT----CAGCCTATATACCGCCATCTTCAGCAAACC-CTGATGAAGGCTACAAAGTAAGCGCAA-GT-ACCCA-CGTAAAGACGTTAGGTCAAGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTACATTTTCT-ACCCCAGAAAACTACGATAGCCCTTATGAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTGAGAGTAGA------GTGCTTAGTTGAACAGGGCCCTGAAGCGCGTACACACCGCCCGTCACCCTCCTCAAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGCATTTATATAGAGGAGACAAGTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAACCAG
   6.621 +s mouseMito    458 569 + 16299 TTTATAATACACGACAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGCCATAAACCTAAATAATTAAATTTAACAAAACTATTTGCCAGAGAACTACTAGCCATA--GCTTAAAACTCAAAGGACTTGGCGGTACTTTATATCCATCTAGAGGAGCCTGTTCTATAATCGATAAACCCCGCTCTACCTCACCATCTCTT----GCTAATTCAGCCTATATACCGCCATCTTCAGCAAACC-CTAAA-AAGGTATTAAAGTAAGCAAAA-GA-ATCAAACATAAAAACGTTAGGTCAAGGTGTAGCCAATGAAATGGGAAGAAATGGGCTACATTTTCTTATAAAAGAACATTACTATACCCTTTATGAAACTAAAGGA-CTAAGGAGGATTTAGTAGTAAATTAAGAATAGA------GAGCTTAATTGAATTGAGCAATGAAGTACGCACACACCGCCCGTCACCCTCCTCAAATTAAATTAAACTTAACATAATTAATTTCTAGACATCCGTTTATGAGAGGAGATAAGTCGTAACAAGGTAAGCATACTGGAAAGTGTGCTTGGAATAATCAT
   6.622 +s fuguMito     462 556 + 16447 CTC-GAACCCACGAAAGCTAGGACACAAACTGGGATTAGATACCCCACTATGCCTACCCCTAAAC---ACGATATGAAAC-TACGTACATATCCGCCTGGTTACTACGAGCATTA--GCTTAAAACCCAAAGGACTTGGCGGTGCTTTAAAACCATCTAGAGGAGCCTGTTTTAAAACCGATACTCCCCGTTCAACCTCACCCCTCCTT----GTTTTAACCGCCTATATACCACCGTCGTCAGCCTACC-CTG-TGAAGGGCAAATAGTAGACAAAA-TTGGCACA-GCCAAAAACGTCAGGTCGAGGTGTAGCGAATGGAGGGGGACAAAATGGGCTACATTCTCT--GCCTAGAGAAC-ACGAAAGATGTGCTGAAA-TGCACACCCGAAGGAGGATTTAGCAGTAAGCAAGAAATAGA------GTGTCATGCTGAAACCGGCTATGAAGCGCGCACACACCGCCCGTCACTCTCCCCA---AActcttaatttaaaaataactaATAAGCC--AccaaaagaaaaggggaggcAAGTCGTAACATGGTAAGTGTACCGGAAGGTGCACTTGGAAAAACCGG
   6.623 +p                              ;<<<=BDGPY_a_abgmoollonihiihinnjhjnlloooonhgghnoooooollnlecad^\ZTRKB?>85432.,*%"",/8=>?BJOPQRU^dffc_ZZ_dlnkfkmkjjej~~nnkjhffhnonihijkkcachimkkjeiecbhlmlecbimnoonkloolloolkmjejjkoooonihhgffgieiiceijnmjeb\SPI@><~~~~6-$*--$*-6>@JS\acejknlloonkjg_ULB@>86~4.&%#")*++,,,.469@DEEEDA?>=~80~-&&#""-08=>?@CMV]`hjkookkkknoookca_bjib_`ecbafhlihimighf^TKA8532-$"''()+.4667=>AJPRWWUNMMMMMMKD;871(%%%#"!!/18:@BDLNW]^aijfknmged`a`checillk~~~~~~ieimjiecgilgd_^_^aa_`hmkje^^`a`fijkkjkmjhjnoomgee`XUNE;92/((('''%%$$$##""""""""""""""""""""""""######-6?FIOSY[`dlooookklfcgimkjgaaglookkihihec``dijigb__bcbdhe
   6.624 +p                              :::;;>@AEIKLMOPTY^cglqv{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zyyxurniedhmrv{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{zvrn~~~~ie`[[[[`einsx|~~~~~~~~~~~~~~~~~~~}xto~jea`^]______``dfghhhhhgffff~ec~cbaa``bbgknpqvz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vqmhc^YZZZZ[_beffhimprrvyz{~~~~~~~~~~~zupomjfbacchloqrw{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vqlhc^YUPKFA=<:999987765444444444444444444444444444444456:?DIMQTVW\aejotx}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
   6.625 +p                              $%%'(,/015789;;@EILNOSX]adgginnjhjnlloooonhgghnooookdadknihiib_]WVUNLLKJFDCBA@@@~@CIKKLLLMMMOSUUSLLLKKKKKIC:70'$"""""-0:CKPRT]ddaceijkcachimkkmjb]\^^YYWWWVX~~~~~~~~~~~~~~~~~gkkkooonkc`_`_^ce`WTTTUURRRQPNIB975/"#&,"$&~~~~09AGLTY[acegjjcaZXQHFD>5,)''&%$+125<>>>>>>>>>>>HPSNNLE<920!!"~#$%&)~279;ABEJLQRT]dgmnkkkjiehf^URPOJB8885.,""%.468AGIKU^gmkda`^ZR~I?=;:95-+)(#$-5788899:;<>AIPSTTTSRRRSTUY[cgihgdgimjhjnooonlfd`YWRNJA854.,"$())("$)*++,/8<>@ABILT\``djjcacgdimomlieijkmihijbYQHEC>5220*"$"#$$$$$$%%&''),---....///011222235566778:<??FLNORSST]cflooookklfcgimllnoooleceeb`^`a^ZVPJF@?91'%####"
   6.626 +p                              #$$&'+./04678::?DHKMNRW\aejoty}~~~~~~~~~~~~~~~~~~~~~~~~~~~~}ytojfec`__^^^^]]]]]]~]^^^^^^^^___bddeeeeeeefffeedb_[ZZZYY^chlqv{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zzyxutttrplhcba]YYYY]^_~~~~dimrvyz{~~~~~}yupomjiiigea``_^[[\\\\\\\[[[[[[[[[[[[[[[ZZZYVVW~WZ[\\~]]^^_````aabglquz~~~~~~~~~~~~~}zvvtqmhddinsx|~~~~~~~~~~|wsni~d`_]\\\[YUTSSSSSSSSSSSSSTTTTTTTTTTTTTTUWX\aehjkosuvwwwvsplgc^YTSRNJFA@@?????????@CEFFHHKLMOPQRSWZ\]aehjjmoptxz{|{zzywtplgb^YTOKFA<7752........................................../2348;=>BEGHMQV[`dinrvy{{~~~~~}ytpkfa`_[WSRPMIE@;621/,('%%$#"
   6.627 +p                              %$$#,2366?FHIIIS\ejcacgdadgginnjhjnlloooonhgghnonmlg^ZYTLKKJF>7.%&&#&&'()+--355:~;=>?????AAACHNPUVWWXZ_cknonkdZWWYb~~jnkjgeefdadgghjjkcachinklnnja_]][\\```~~~~~~~~~~~~~~~~^][[\]^ailib^_abcehcfljgaXVNLDA>=:9831~~~~0*((**((+4;>GPX[]`ffdefdiicficZQGEC=;~94+&(+++++++,,,,,,,,,,,,,,+~*)"#%%*,~,,.34569BILLU\_giceijnoonia][\WNKKKKMMMOOOTVYaeee^UKIA85433/~!!"#$%%%%%%$$,49;;==<;:98874-*)#$%&&')*-7@FIOPSY\egginoonjbXVSRLJIJLMW`gj~~~~~~f`XONNOSTUVTRQQRTV[[]dkkkmmlkieikkllkkmihgf_USKDB@><860!#$!"#$%'(+++,,--./02455555443220!!!!"""##$%&'*014=BDFNQZckooollooollnllnooolecffb`_bjnoonkkhga]]_`b`]]
   6.628 +p                              )))).2567;=>?AAFKNRSTX[]^chlqv{~~~~~~~~~~~~~~~~~~~~ytonmiigd`\WSNIIIIIIIIIIIJJJJ~JJJJJJJJJJJKNOPPPPPQQV[`dhjlmmmmns~~x|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zupkgba__^^]~~~~[WWUUUUWX]afkpty|~~~~~~~~~|{zwtokjjig~ea\XXXXXXXWWWWWWWWWVTTTSSSS~SSRSSSTT~TTUY\^_dhkmmrw{~~~~~~~~~~~~~~~~~|{{{{{zzyyyyywuqlhc^ZUPKGFDA~============<<<<<<<<<<<<<<<<<<<<<<<====>CGLPSUVZ_dimrw{~~~~~|xwvuuvwx|~~~~~~~~~~~|xwwwxy{|}|{{{~~~~~~~~~~~~~~~~}zvqmhc^ZUPKFB=8752.*)'$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$%&'*,-158:;@EINSX\afkpty~~~~~~~~~~~~~~~~~~~~~~|xsnie`__^\ZVU
   6.629 +
   6.630 +a
   6.631 +s chickenMito 2432 295 + 16775 A-GTATAGGCGATAGAAAAGACTACCCC--GGCGCAATAGAGGCTAACTGTACCGCAAGGGAAAGATGAAATAGCAATGA------AAACC-----ATAAGCAAAAAACAGCAAAGACCAACCCTTGTACCTTTTGCATCATGATTTAGCAAGAAC-AACCAAGCAAAGTGAGCTAAAGTTTGCCTTCCCGAAACCCAAGCGAGCTACTTGCGAGCAGC--TAAAATTTGAGCGAACCCGTCTCTGTTGCAAAAGAGCGGGATGACTTGCCAGTAGAGGTGAAAAGCCTACCGAGCTGGGTGATAGCTGGTT
   6.632 +s humanMito   1742 281 + 16571 A-GTATAGGCGATAGAAATTGAAACCT---GGCGCAATAGAT----ATAGTACCGCAAGGGAAAGATGAAA----AATTA------TAACC-----A--AGCATAATATAGCAAGGACTAACCCCTATACCTTCTGCATAATGAATTAACTAGAAATAACTTTGCAAGGAGAGCCAAAGCTAAGACCCCCGAAACCAGA-CGAGCTACCTAAGAACAGC--TAAAA---GAGCACACCCGTCTATGTAGCAAAATAGTGGGAAGATTTATAGGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGCTGGTT
   6.633 +s mouseMito   1164 285 + 16299 AAGTATTGGAGAAAGAAATTCGTACATCTAGGAGCTATAGAA----CTAGTACCGCAAGGGAAAGATGAAA----GACTA------ATTAA-----A--AGTAAGAACAAGCAAAGATTAAACCTTGTACCTTTTGCATAATGAACTAACTAGAAAACTTCTAACTAAAAGAATTACAGCTAGAAACCCCGAAACCAAA-CGAGCTACCTAAAAACAAT--TTTAT---GAATCAACTCGTCTATGTGGCAAAATAGTGAGAAGATTTTTAGGTAGAGGTGAAAAGCCTAACGAGCTTGGTGATAGCTGGTT
   6.634 +s fuguMito    1182 292 + 16447 A-GTATAGGAGATAGAAAAGGAA-CTA---GGAGCTATAGAT----AAAGTACCGCAAGGGAACGctgaaa----gagaaatgaaataacccagtaa--agtaaaaaaaagcagagattaCACCTCGTACCTTTTGCATCATGATTTAGCTAGTA-TAATTAGGCAAAGAGCACTTTAGTCTAACACCCCGAAACTGAA-TGAGCTACTCCAAGACAGCCTTTATA---GGGCACATCCGTCTCTGTGGCAAAAGAGTGGAAAGAGCTTTGAGTAGAGGTGATAAACCTACCGAGTTCAGTTATAGCTGGTT
   6.635 +p                              ""0:CILRSV]]YWUMG?6,*(''&%$%%$+01366@IRXZY~~~~Y~~~~~~~~~~~~~~~~~~~~~~~~~~~~JJHHG~~~~~~EEEEF~~~~~H~~HHGGGGGGGHMV^_^^`eab_][[[[^_gkjiebaelooollonigceijkd[WOLGDDDDDDEGIIKLMOPPPRTXY]fhaXSSSTVWY[dgfhiiebe~looooookkkda_abb[WV~~UTTTT~~~TQOMMMSWW]fmooonmicfkhffhnonlebeijnldba`djkkooonigdfa[[[[bdidadknkcachinooole\RIF?<
   6.636 +p                              WWZ[[\\\\\\\\\\\\\[ZXWWWWVVVVVXZ[^``eilmnn~~~~otx}~~~~~~~~~~~~~~~~~~~~z~~~~utrrp~~~~~~nmmmm~~~~~n~~nnnnnnnnootx|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vqmhggggggggggghiiiiijllqtvwxwxz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}yut~~tssss~~~ssrrssvxy~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|w
   6.637 +p                              '~+058;=>>>>=;4+('%$$#"""!!!~~24=ABBAA=6-$)**$)*-6?HQX^cfhgfc`^YQHE>52+'),)')--.~~~~~~/00/+~~~~~#)#-467789;@BEMSUVX^cbacda_]\^`gkjiebaelmh`VTMC:777543//-&$"!*+,,.09>???ACKOOOKIHGB:75432211111.,+&#""""0:CMV]`^\\[\^]\\\XP~~G=:4**0**39;;=GPX^gkkieikfdjlgeeedhhdeefdbfbYYYVUTTWaimmigdfa[[[[belnllnmf]Z[~~~~~~~~~~~~~~
   6.638 +p                              %~)-/11122222222222222222222~~22222222222222223348=BGKPUX[]]^^^^^^]][YUQQQQQQQQQ~~~~~~QQQQQ~~~~~QQQUY\]]`aacdimqtvw{~~~~~~~~~~~~~~~~~~~~~~~~~~~}xxvsonlljhe``abbbbcgjlmmooqrrrrrrrpnmkkkkklmnnnnnmkhdccbglptwyzzzzyz{{{||{y~~vrmid___cfghhinsx|~~~~~~~~~~~~~~~~~~~~~~~~~~~~}zyyz~~~~~~~~~~~~~~~~~{vrmhc_ZYYXVTPKGB=84/*%
   6.639 +p                              '~-16:=?@@AAA@:1.-'$$#"!,.0~~~68;CIKNW_egg~~~~dadijihgd^VMJC:74//,,+*)(~~~~&&$#"&&'%#"'((('###$$$~~$%%&&'(()+-233347=>AAABCCCCFOX^`ba`dknmibb^UKIHHGEE@8/%"".357<>@CDDDDDDDAA@?>==<88888889:<?GLMNOOOOS~V_daYPG=8888777773+''')..0~~~124;==>>HQZcffdgjhcfkgeeediljb_^_`a^VTTTUTTXaimnihejkg~~~~~~~~~~~~TRQRTUUVVVTQMID?:
   6.640 +p                              %~*/37:<==>?????????????@@@~~~CEFIKKPTX[]^~~~~^^^^^^^^^]\YVQMHC>=<;:840~~~~+*(((''''''''''''''''+~~--./0233558:;;;<===>>>>????@EJNRUWX]adghhjkkkkkkkjjjigdcabccccccdddddddddccccccccccdddeinrtvwwvvtsss~sttsrpmidccccccccba^^__abe~~~ghlquxz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~{wrmid_ZVUTTTTTTTSROKGB>9
   6.641 +
   6.642 +a
   6.643 +s chickenMito 3125 433 + 16775 GTTAAGCCAACCCAGGAGCGCCCACAGG--ATGATTAAAACCTACAGAAGGAACTCGGCAAACCAAA--GACCCGACTGTTTCCCAAAAACATAGCCTTCAGCTAACAACAAGTATTGAAGGTGATGCCTGCCCAGTGAC-CCCCAAAGTTCAACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGCAATCAATTGTCCCGTAAATTGAGACTTGTATGAATGGCTAAACGAGGTCTTAACTGTCTCCTGTAGGTAATCTATGAAATTAGTATTCCCGTGCAAAAACGAGAATGTGAACATAAGACGAGAAGACCCTGTGGAACTTTAAAATCACGACCACCTTACA-ACCTTA---CACAGCCCCACTGGGTCCACCCACACATAAACCCCTGGTCGACATTTTTCGGTTGGGGCGACCTTGGAGAAAAAAAAATCCTCC
   6.644 +s humanMito   2422 423 + 16571 GTCAACCCAACACAGGCATGCTCATAAGGAAAGGTTAAAAAAAGTAAAAGGAACTCGGCAAACCTTA--C-CCCGCCTGTTTACCAAAAACATCACCTCTAGC--ATCACCAGTATTAGAGGCACCGCCTGCCCAGTGAC-AC---ATGTTTAACGGCCGCGGTACCCTAACCGTGCAaaggtagcataatcacttgttccttaaatagggacctgtatgaatggctccacgagggttcagctgtctcttacttttaaccagtgaaattgacctgcccgtgaagaggcgggcatgacacagcaagacgagaagaccctatggagctttaatttaTTAATGCAAACAGT-ACCTAA---CAAACCCACA------GGTCCTAAACTACCAAACCTGCATTAAAAATTTCGGTTGGGGCGACCTCGGAGCAGAACCCAACCTCC
   6.645 +s mouseMito   1857 424 + 16299 GTTAACCCAACACCGGAATGCCTA-AAGGAAAGATCCAAAAAGATAAAAGGAACTCGGCAAACAAGAA-C-CCCGCCTGTTTACCAAAAACATCACCTCTAGC--ATTACAAGTATTAGAGGCACTGCCTGCCCAGTGAC-TA---AAGTTTaacggccgcggtatcctgaccgtgcaaaggtagcataatcacttgttccttaattagggactagcatgaacggctaaacgagggtccaactgtctcttatctttaatcagtgaaattgacctttcagtgaagaggctgaaatataataataagacgagaagaccctatggagcttaaATTATATAACTTATCTATTTAATTTA---TTAAACCTAA------TGGCCCAAAAACTATAGTATAAGTTTGAAATTTCGGTTGGGGTGACCTCGGAGAATAAAAAATCCTCC
   6.646 +s fuguMito    1916 428 + 16447 GTTACCCCTACACTGGTGTGCCAAATAGGAAagactaaaagaaaaagaaggaactCGGCAAACTCAAAGC-CTCGCCTGTTTACCAAAAACATCGCCTCTTGC--TTCAAT-GAATAAGAGGTCACGCCTGCCCTGTGACTAT---ATGTTTAACGGCCGCGGTATTTTGACCGTGCAAAGGTAGCGCAATCACTTGTCCTTTAAATGTGGACCTGTATGAATGGCATAACGAGGGCTTAGCTGTCTCCTTTCTCAAGTCAATGAACTTGATCTCCCCGTGCAGAAGCGGGGATAAAACCATAAGACGAGAAGACCCTATGGAGCTTTAGACAAAAAACAGCCCCTGT-CAATAAACCCTAAATAAAG------GGAATAAACCTAGTGAACCTGTTTTAATGTCTTTGGTTGGGGCGACCGCGGGGTAACAAAAAACCCCC
   6.647 +p                              :<=BGKOSUVWVRJGF@@=7.$$##+-46<=?DEFFGGGGGHHHQVWX[achhh`WNKD:860'%#"!~+~-.1:ADNV\^`hjigeeegmoooollnooooo~~lfcfcacknollnonllnlfcijkonjhjnoomhb~YY~~~[[cffhjknkkkknnkkmibcehceijnoonihikkoooooolloooollnkkkjihca_bihgge\YZ`ahmnihehikg``cjnmhffc`cdcjnoonnmge_VVXY[`a`cknonihikknnhf`]\^_gmnlknnjie\[YXYXTSTVWZZ\belnooonklnnjhjnomge^ULB?:860.''''''&&&&&&%%#""(())*+~~~+++++++++,~~~~~~,,,,,,,,,,,---./00244457889:<>EHJSZ]cdeddddjnllonkjhe_^\[ZWVVVVZ[WNL
   6.648 +p                              8:;?DHLOQRRRRRRRRRRRRRRRRW\`ehklmmnnoswz{||}~~~~~~~~~~~~~|xsnie`___^~c~hmqv{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~yxwvvvutuuuvvw|~~~~~~~~~~~}xtojea\WRNID?><951000//--------,,,,,,,,,~~~,,,,,,,,,,~~~~~~,,,--------------------/0015:?DIMRW\`eilnopqqrrqpnkgc^][[ZWWVVVVVVUR
   6.649 +p                              5667788888888885.,+++++)('##"")+..7<>???????@CDHLRV[_cc]TQJA><74-+)~~#")+-57AJRVVWXY[__````YTKIHGA;983+'&'(*1458AJNOOOORUVUTUW`ehmnigcZQH?5+~)'''')+5=BDLOW^afhmnkkmibcelkkkknomibceijnmhd``dhmlecghha^_``dfefd`a`chcadknooollnlklg``cike\YUTVVYYcjmjgb\VUSRRRTX\\YZXXagecb][TTUVYZ_acihaXWWXXY_`^``b_YPNLKKKN~~~~~~~~~~~~~~~~]\YVQMLIFC=9544332222211111111~1111/.~~~-,+*''&&&&"#####!!"$$%%%%&&&&&&&'-/111112222223333333333333333333333210//.,,,,,+++*(
   6.650 +p                              ..//000000000000000000000000001133567777777789:?DIMRVYZ[[[\\[[[[ZZZ~~ZY^beghmqvz|~~~~~~~~zupkgffec```_^[[\\]`bbgjmnnnnooooooppuy}~~~~|ytpkfb~]\ZZZ\]adfgkpuz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zutrrrrruvwwwwx|~~~~~|xxxxzz~~~~~~}|zzyyyyyxxxwvtsssssswyz{zywtpkgb]XSOJIGD@;;962-($##"""""""""""""""~""""""~~~""""""""""""""""""""""""""""""""""#########$$%()**++++++++++++++++***))))(''&&&&&&%#
   6.651 +p                              ()*,,0356:<>??@@@@BBBBCCCDINRVXZZYY[[ZYWUUUTTVVZ]cfijkh`WQH?<5,)('&$$(~)),36?IPRY\eijgeeegmonjeghf^UKIA~~885.%"",/7=?FMOPPNMNQZ`bgcZXVPNG>4+&(+~~~4>FLNPXZchikknnkkkf^\\^_dhjnoonihikknmhd``dhmoonhgaXUUUWY]^_`[Z_aikkoooooollnigaYY[`hmkdba\\\elnljd^VMJJIHHIIJLLNTXX`fdbafhmjcef`abelmjcegc`chdba`fe^]\\YVVY~~~~~~~~~~~~~~~~~~~~~~~~~~~.---,,,,,++++++++++~*****(&'&%&''''''((~~~~~~(((((((()*,,,,,------------------------------,,,,+*((&&%%%%%%%$$$$##
   6.652 +p                              #$$&'+.0047999:;;;<====>>?DIMQTUVVW[_bdeefgggijotx|~~~~}zvrmhc_ZYYYXX\~]^chmqv{~~~~~~~~~~~~~~~}}{xtokjh~~edb`\[[\]`bbfijkkkllqvz}~~~~}yxwtpkfhi~~~nsx|~~~~~~~~~~~~~~~~}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~yutrqqqqqrrsvxx}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~}xsoje`\WRMHD?:51,'&&&&&&&&&&&&&&&&&&~&&&&&&&&&&&&&&&&&&&~~~~~~&&&&&&''((((((()))))))))))))))))))))))))))))))))))(&&%%$$########"""
   6.653 +
   6.654 +a
   6.655 +s chickenMito 3635 194 + 16775 AATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCAAGAGCCCATATCGACAAG-GAGGTTTACGACCTCGATGTTGGATCAGGACAACCTAATGGTGCAACCGCTATTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTA
   6.656 +s humanMito   2914 193 + 16571 AACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCTAGAGTCCATATCAACAAT-AGGGTTTACGACCTCGATGTTGGATCAGGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAA-AGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTA
   6.657 +s mouseMito   2353 194 + 16299 AACGGACCAAGTTACCCTAGGGATAACAGCGCAATCCTATTTAAGAGTTCATATCGACAATTAGGGTTTACGACCTCGATGTTGGATCAGGACATCCCAATGGTGTAGAAGCTATTAATGGTTCGTTTGTTCAACGATTAA-AGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTA
   6.658 +s fuguMito    2433 193 + 16447 AACGAACCGAGTTACCCTAGGGATAACAGCGCAATCCTCTTTTAGAGTCCATATCGACAAG-AGGGTTTACGACCTCGATGTTGGATCAGGACATCCTAATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAA-AGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCAGTTTCTATCTA
   6.659 +p                              Z`chhcachinllnjhjnnjhjnollooooonllnllmia^YY\ekjb_aa\SJ@764-*##,246<>@JS]fijnoooookkkkoooollooonhffcelkkljehgaahlonjiecafhjkonjhjnklnlloookkih~inollooooooooooooollooookkkknkehjnllnllookkihinooonjb
   6.660 +p                              bgkortuz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{zvrninsx|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
   6.661 +p                              ;==ADFGLPSUUZ^`a``ghhinnlloooonmgc[URQRSTUWZcihbcelnonjcehb^Y~WW~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~a_^\]`hjknolfcginooniga_^_aginnjhimihcZXQG>42*(&+4>EHQ[dkooooooooollooookkkknkehjnllnllookjhfebZQH>5+
   6.662 +p                              678<?ABFJNOPUZ^acchmrw{~~~~~~~~~~~~~|{|}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|xsninsx|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zuqlgb^
   6.663 +p                              ),.//01348=BGLPUZ_cfgimnllooooonllnkihbba`dknooollnoonjdfkige~ihhiihinooollooooookkkkoooolloonkca_`~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~YXVRNIE@;61,
   6.664 +p                              %(**+,,./49>BGLQUZ_dhmrw|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vrmhc_ZUPOMJFB=84/*%
   6.665 +
   6.666 +a
   6.667 +s chickenMito 4097 1794 + 16775 ATTCTCCCCATCCTAATCGCCGTGGCCTTCTTAACACTTGTAGAACGAAAAATCCTAAGCTACATGCAGGCCCGAAAGGGCCCAAACATTGTGGGCCCTTTTGGTCTACTCCAACCCGTTGCAGACGGGGTAAAACTATTCATTAAAGAGCCAATCCGACCATCTACCTCCTCCCCCTTCCTCTTCATTATTACTCCAATCCTAGCACTACTCCTAGCCCTGACTATTTGAGTCCCCCTCCCACTACCATTCCCCCTTGCAGACCTCAACCTAGGACTACTATTTCTCCTAGCCATATCAAGCCTAACTGTCTACTCTCTACTCTGATCCGGATGAGCATCAAACTCCAAGTATGCCCTAATCGGAGCCCTTCGAGCCGTCGCACAAACAATCTCATACGAAGTCACCCTAGCCATCATCCTGTTATCCACAATCATACTGAGCGGCAATTACACCTTAAGCACCCTGGCCATCACCCAAGAGCCCATCTACCTCATTTTTTCCGCATGACCCCTCGCAATAATATGATACATCTCTACCCTTGCTGAAACCAACCGCGCCCCATTTGACCTAACAGAAGGAGAGTCAGAGCTAGTCTCAGGATTTAATGTAGAATATGCCGCCGGACCATTCGCCATATTCTTCTTAGCCGAATACGCCAACATTATACTAATAAACACACTAACCACCGTCCTATTCCTGAACCCAAGCTTCCTAAATCTCCCACCAGAATTATTTCCCATTGCACTCGCTACAAAAACCCTCCTCCTTTCATCCTCATTTCTATGAATCCGGGCCTCATATCCACGGTTCCGCTATGACCAACTAATACATCTTCTATGAAAAAACTTCCTCCCCCTAACCCTAGCCTTATGCCTCTGACATACCAGCATACCAATCAGCTACGCCGGCCT--CCCCCCAATCTAAG---GAAGCGTGCCTGAACAA-AAAGGATCACTATGATAAAGTGAACATAGAGGTATAACAACCCTCTCACTTCCTTAATCC--TAGAAAAGTAGGAATCGAACCTACACAGAAGAGATCAAAACTCTTCATACTCCCTCT---ATATTATTTTCT-AGTAAGGTCAGCTAACTAAGCTATCGGGCCCATACCCCGAAAATGATGGTTT-AACCCCTTCCCCTACTAATGAACCCCCATGCAAAACTAATCTGCACAGTAAGCCTCATCATGGGAACCAGCATCACAATCTCCAGCAACCATTGAATCTTAGCCTGAACAGGCTTAGAGATCAACACCTTAGCCATCATCCCCCTCATCTCCAAGTCACACCACCCCCGAGCGATTGAAGCCACTATCAAATATTTCCTCACCCAATCAACTGCATCAGCCCTAATCCTCTTCTCGAGCATAACCAACGCCTGATCCACCGGACAATGAGACATTACACAACTAAACCACCCGACATCATGCCTA-ATATTAACAATAGCAATCGCAATCAAATTAGGACTAGTCCCATTCCACTTCTGATTCCCAGAAGTACTCCAAGGCTCCTCCCTAATCACTGCCCTACTACTCTCCACCCTAATAAAACTCCCCCCAATCACACTCCTCCTCCTAACATCACAGTCTCTTAATACCACCTTACTCACCCTCCTAGCAATCTCCTCCACCCTAATCGGAGGCTGAATGGGCCTAAACCAAACACAAACACGAAAAATCCTAGCCTTCTCATCCATCTCCCATTTAGGATGAATAATTATAATTATCTCCTATAACCCACAACTCACTATTCTCACCTTCATCCTCTACACAATTATGACCTCAACTGTATTCCTA
   6.668 +s humanMito   3334 1787 + 16571 ATTGTACCCATTCTAATCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCTCAACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTCAATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGCAGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACTAATAAGTGGCTCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCATCATGACCCTTGGCCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCTTCGACCTTGCCGAAGGGGAGTCCGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAGGCCCCTTCGCCCTATTCTTCATAGCCGAATACACAAACATTATTATAATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACTCTACACAACATATTTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCCTAGCATTACTTATATGATATGTCTCCATACCCATTACAATCTCCAGCATTCCCCCTCAAACCTAA---GAAATATGTCTGA--TA-AAAGAGTTACTTTGATAGAGTAAATAATAGGAGCTTAAACCC---------CCTTATTTc--taggactatgagaatcgaacccatccctgagaatccaaaattctccgtgccacctatcacaccccatcctaA-AGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGG-TT-ATACCCTTCCCGTACTAATTAATCCCCTGGCCCAACCCGTCATCTACTCTACCATCTTTGCAGGCACACTCATCACAGCGCTAAGCTCGCACTGATTTTTTACCTGAGTAGGCCTAGAAATAAACATGCTAGCTTTTATTCCAGTTCTAACCAAAAAAATAAACCCTCGTTCCACAGAAGCTGCCATCAAGTATTTCCTCACGCAAGCAACCGCATCCATAATCCTTCTAATAGCTATCCTCTTCAACAATATACTCTCCGGACAATGAACCATAACCAATACTACCAATCAATACTCATCATTA-ATAATCATAATGGCTATAGCAATAAAACTAGGAATAGCCCCCTTTCACTTCTGAGTCCCAGAGGTTACCCAAGGCACCCCTCTGACATCCGGCCTGCTTCTTCTCACATGACAAAAACTAGCCCCCATCTCAATCATATACCAAATCTCTCCCTCACTAAACGTAAGCCTTCTCCTCACTCTCTCAATCTTATCCATCATAGCAGGCAGTTGAGGTGGATTAAACCAAACCCAGCTACGCAAAATCTTAGCATACTCCTCAATTACCCACATAGGATGAATAATAGCAGTTCTACCGTACAACCCTAACATAACCATTCTTAATTTAACTATTTATATTATCCTAACTACTACCGCATTCCTA
   6.669 +s mouseMito   2777 1787 + 16299 CTCGTCCCCATTCTAATCGCCATAGCCTTCCTAACATTAGTAGAACGCAAAATCTTAGGGTACATACAACTACGAAAAGGCCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTTATAAAAGAACCAATACGCCCTTTAACAACCTCTATATCCTTATTTATTATTGCACCTACCCTATCACTCACACTAGCATTAAGTCTATGAGTTCCCCTACCAATACCACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTATGATCAGGATGAGCCTCAAACTCCAAATACTCACTATTCGGAGCTTTACGAGCCGTAGCCCAAACAATTTCATATGAAGTAACCATAGCTATTATCCTTTTATCAGTTCTATTAATAAATGGATCCTACTCTCTACAAACACTTATTACAACCCAAGAACACATATGATTACTTCTGCCAGCCTGACCCATAGCCATAATATGATTTATCTCAACCCTAGCAGAAACAAACCGGGCCCCCTTCGACCTGACAGAAGGAGAATCAGAATTAGTATCAGGGTTTAACGTAGAATACGCAGCCGGCCCATTCGCGTTATTCTTTATAGCAGAGTACACTAACATTATTCTAATAAACGCCCTAACAACTATTATCTTCCTAGGACCCCTATACTATATCAATTTACCAGAACTCTACTCAACTAACTTCATAATAGAAGCTCTACTACTATCATCAACATTCCTATGGATCCGAGCATCTTATCCACGCTTCCGTTACGATCAACTTATACATCTTCTATGAAAAAACTTTCTACCCCTAACACTAGCATTATGTATGTGACATATTTCTTTACCAATTTTTACAGCGGGAGTACCACCATACATATA----GAAATATGTCTGA--TA-AAAGAATTACTTTGATAGAGTAAATTATAGAGGTTCAAGCCC---------TCTTATTTc--taggacaataggaattgaacctacacttaagaattcaaaattctccgtgctacctaa-acaccttatcctaATAGTAAGGTCAGCTAATTAAGCTATCGGGCCCATACCCCGAAAACGTTGG-TTTAAATCCTTCCCGTACTAATAAATCCTATCACCCTTGCCATCATCTACTTCACAATCTTCTTAGGTCCTGTAATCACAATATCCAGCACCAACCTAATACTAATATGAGTAGGCCTGGAATTCAGCCTACTAGCAATTATCCCCATACTAATCAACAAAAAAAACCCACGATCAACTGAAGCAGCAACAAAATACTTCGTCACACAAGCAACAGCCTCAATAATTATCCTCCTGGCCATCGTACTCAACTATAAACAACTAGGAACATGAAT-ATTTCAACAACAAACAAACGGTCTTATCCTTAACATAACATTAATAGCCCTATCCATAAAACTAGGCCTCGCCCCATTCCACTTCTGATTACCAGAAGTAACTCAAGGGATCCCACTGCACATAGGACTTATTCTTCTTACATGACAAAAAATTGCTCCCCTATCAATTTTAATTCAAATTTACCCGCTACTCAACTCTACTATCATTTTAATACTAGCAATTACTTCTATTTTCATAGGGGCATGAGGAGGACTTAACCAAACACAAATACGAAAAATTATAGCCTATTCATCAATTGCCCACATAGGATGAATATTAGCAATTCTTCCTTACAACCCATCCCTCACTCTACTCAACCTCATAATCTATATTATTCTTACAGCCCCTATATTCATA
   6.670 +s fuguMito    2873 1788 + 16447 ATTGTACCCGTTCTACTAGCCGTAGCTTTCTTAACATTAATTGAACGAAAAGTTTTAGGTTACATGCAGTTACGAAAGGGCCCCAACATCGTAGGACCTTACGGACTCCTCCAACCCATCGCCGATGGCGTTAAACTTTTCATCAAAGAACCAGTCCGACCATCTACCTCCGCTCCCATCCTATTCATTATTGCCCCTACACTAGCCCTTACTCTCGCCATAATAATATGAACACCAATGCCCCTCCCCTACCCCATCCTTGACTTAAATCTGGCCATTCTATTTGTCCTAGCTATCTCTAGCTTGGCAGTCTACTCTATTCTGGGCTCCGGATGGGCCTCCAACTCAAAATATGCCCTTATAGGATCCCTACGAGCAGTTGCACAAATAATCTCATACGAAGTAAGTCTAGGGCTAATCCTTTTATCattgattatttttacaggcAACTTTACCCTACAAACATTTAACGTCACCCAGGAAAGCATTTGACTAATCATCCCAACATGACCCCTTGCAGCAATATGATACATCTCCACGCTAGCCGAAACAAACCGAGCCCCCTTTGACCTAACAGAGGGGGAGTCCGAACTGGTATCTGGGTTCAATGTTGAATATGCAGGAGGTCCCTTTGCCCTATTTTTTCTGGCAGAATATGCCAACATCCTCTTAATAAACACGCTCTCCACAATCCTGTTCCTAGGAGCCTTACATATGCCCGCTCTTCCAGAACTAACCTCTATCAATTTAATatcaaaaacagccattttatcCCTCATCTTCCTATGAGCCCGAGCCTCCTACCCACGATTCCGATATGACCAGCTAATACACCTCACATGAAAAAACTTCCTACCACTTACATTAGCATTCATTATCTGACATCTTGCACTCCCAACTACAATAGCAGGCCTTCCCCCTCAAATATAAAAGGAACTGTGCCTGA--AACAAAGGACCACTTTGATAGAGTGAATCATGAGGGTTAAATTCC---------CTCCAGCTCCTTAGAAAGAAGGGACTTGAACCCAACCCGGAGAGATCAAAACTCTCAGTGCTTCCACT---ACACCACTTTCT-AGTAAAGTCAGCTAAATAAGCTTTTAGGCCCATACCCTAAAAATGGAGG-TTAAAATCCCCCCTTTACAAATGAACCCTTATATTACTGCCTCCCTTTTATTTGGCCTGCTGTTAGGTACAACTATTACAACTACCAGCACACACTGACTAATTGCATGAATGGGCCTAGAAATTAACACCCTAGCTATTATCCCCCTAATAGCCCAACAACACCACCCACGAGCAATTGAAGCCACTACAAAATACTTCTTGACTCAAGCTGCCGCAGCAGCAACCCTCCTCCTCGCAGCTACAACCAACGCCTGAATAACAGGCCAATGAGAGCTACAGCAAGCTACCCACCCAGTCCCAACAACC-ATAATTACCATTGCATTAGCCTTAAAAATTGGACTAGCCCCACTCCACACCTGACTCCCAGAAGTAATACAAGGACTAGACCTTACAACTGGACTTATCCTGGCCACATGACAAAAAATCGCACCATTCTCCCTTCTATTACAAAT---TCAACCTAATAACCAAACACTCTTAATCCTCCTCGCCATCCTCTCCATACTTGTCGGCGGATGAGGGGGCCTAAATCAAACCCAAGTACGTAAAATTCTAGCCTACTCCTCCATCGCCCACCTAGGCTGAATAGTCATTATTCTTCAATTCTCACCAACCCTAGCTGTAATAACCCTAGCACTTTATATCATCAtaacctcctccaccttcctt
   6.671 +p                               >>>DFIR[aikkoollonkc`beabbafghfaXTNLJJJJKNW^ahe^]\\\XVVYbcbahheilmnklooomh`abdggdba`egiehijdbcc____gje\YWWZZ[_gkihdb`aa`gieknoollnmfdcc`a`a`_a]\^_ac`[YWTTTRQPOOOOPPRTXWVUTTWW[\VVWWWXY[[\abad``ec_`abfb`_aeaa`aaa_ZWW\\^[TSSRRST[`dig`[ZZ[\]_b^^]]`ebZXUUWXXWWWYY[^^``]\]]_aghmia^\\\[\ahhhikecaekjb_`a`hkmoollmiccbhihinnia^__^`dchmooolecbimnlfdjmihike\YZZZcigba`baZZ]egfdfc^]_ahmnlfdjnonihiihimjiebeknoooollmibccaahmlfcfdbea_``^^aefb[WUUUZ^^adghdcbhgd][TKB???>>>>>>??AGILU]ccbiljiebeijnkklkecfdinollnkdadknkkiccbinmged`a`chinnlknooonjhjnnnkc`bcaelooomjd_`_^_aefb__bbbceijnokcaZWWYZbffca_aaagecihgcflnjejmkc`_`__dfhdfdjkkoonkecgdbefdba`egkha^^bijklecbimnlfcgecilmlhbcelnkkmiheijkmihhidffgg`a`_bijf``cjmkkkknldb[VUSRRSQKCBB?>=====>>?@BDMUWainnmiehec\SSTTTTSTTRROMLLLLQRV]fjfchgb__^_\WUUW[^_^ahjcabbachdbfgceacd^_^^bfdhijjidfmonjcfijkfcikkjg`a`_binomfdccdfica_bikeb`cfabb`dlooonjhd\[`ddbdd]ZZYSQJJGFEED@=<<;:6421-,,,,+++++++++++****)(''#"~~~-358AKT]elnoo~~nh~ffhjecginnjhjnoooooonhffc`b`XNKKKKKLMMMOPP~~~~~~~~~PY`cjihin~~oolkkg_`^XX[acdchfe^\YYUUUUWX[dggc`bedegjknnjie]SJGE?=6-$#,23444444331*(&+4>EGNQ[dkookca_bginoooonihiihinmg^\ZYTLIGFA?86/,~%#")+,/68?BGILU_hmniga_`be`^\\^\]___\[[]^`hmooonld\XX_`_afe_[WWY``_ZY[[\``chhe_WSQPOOQU[\YXUUVSQQRQRRSTUWXZbjnoookkjjg__^\[\\]\`_dcimnmg_^`bd^ZXWVV\]ejge`a_]YYYYYY\^`ccddiicdc`cgejjklg`^WTTSSTUX`dabddcikkieijkonjiecgdbfc`bed`]ZZZZ[\[[^_cdcijd`_YY\dged]]\WRQNFCBBCCCB?>>=7.+$#()*+//000111111110/+)(#""""""""""'$)+,---07:ADLQSUYZZ^^ahgffhnonhfaaecfa^]\[\\[^glkkoomiab`bekjcaba_aa_ced`]\\WWWWUTOF=<<<=?BCDEGGJQS\cehecimnoonjb_^]\\]]b_ZZZZZ^_befd]YXXURRSUWWWUQPMLLLLLLU\^[ZZVNMMMKKKKKKLMMMNNNOVZZ[_`]UPOOOSUUXSQQQPPPQQQPOPQY_eeebddaXXXY\bdfffc_a`^_gklg____`^ZZ_fjfcgfaccbilkkihdffhmoooolloookkjcadknlfcghkebeebellfd^[ZTTUVX]\^]YY\]a`_aa\[[ZZWWY[[billjjh`^^]YZYUTTRRRRRTY[\\[[X
   6.672 +p                               SUVY[\`ejosx}~~~~~~~~~~~~~~~~~~~{vqqpppppqvz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}zvusppponmmmmmmmmnnoooooooppppqqqqqqrrsssttuwyy|~~~~~~~~~~~~~~~zvuuttsrrrqqrrw{}~~~}}}~~~~~~~~~~~~~~~~~~~~zyyyyzz{{{{}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zyyz}~~~~~~~~~~~}yywtpkkjjjkkkkkkopqvz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zupkfba_^^^^^]\\\\\\\\\]]^acdhmrvz}~~~~~}{wsrrqqqooooonnnoooqrw{~~~~~~~}}|{zxxxy}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{{zyvutqmmkhgfedbbaa`^ZYXUQPPPPPPPPOOOOOOOOOOOOOOOOOOOOO~~~TY^cglqvz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|wvtqmidcgikklllmmmmmlkhmqv{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|xs~njefghinsx|~~~~~~~~~~~~~~~~~|{{{{|}|{{{~~~~~~~~~~~~~~~~~~~~~{vuuuuussssssssssrpmiihhhhiiiiiiiiiiiiiiiijjkklqvz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}zywutrplgcbbaa`__^^^^]]\[XWVUUUTROKJHEA@?<;;;;;;::::::9865555555555555555555555555555555555589:::;;?CDEFGGHHJLLNOTX]bgkosuvvvwyy~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|xxvsoonnnoqrstuuv{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}{xtonnmlkkkkkjhedbbba``````__^]ZZZYYYYYYYYYYYYYYYZZZZZZZZZZZZZZZZZZZZZZ[[[\\\\]afjmnosuvwxy~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vvuvuvvvvuuuuvvuuutttttttttttttrplhc^]\XXVSSSRRRRRRRRQQQQP
   6.673 +p                               &(**,-26:=?@EINSVY[[Z[`cedbeeb`bec``ed`\[\dijnmfdccdb`chdadklhdggaa[VTTUWWTSSSTUVUUUWY`afgjf^^^][ZYYYZ]]]elnmjcehhdb`[\\dgejlha]]^efffhljehikhaadeglmi`]YYZYXY[\[Z[\[^\[ZVTTUUTUWWX[_egdcggc``\[[\[\]\]YYY\eje_^XOOOQQVVWUTSNFCCCCEEKSWWXYZ[\^a[YWUU[\XVTTVYYZ[\[XWRRRZadknkkkkonigcegcelmgeda`_binnkif``efcflkkleabafdaekgeb]]_^djlmooleabaahmooooonjhjmia^_`ahiejihiidflnigdgdadecjmnlfdijehdadggimklnooonmkg~~~~~~~~~~~~~~~~~~~~cdd`_cjia_``[YXVW^__b`bc^\ZTLJHHHHHHHHIJLNW^aaa^ZYYZZWWXZZ`fghb^^Z[Z_[VOLKKJJJJJJJJJJMU_glia^\[\]_b`cjkknoonjb_`ejkiecfdadecijegdaeijkkjge_^^^^]]```hliga^^``ghhdb`djllfcgecjnoooooonhgba`_ba__bbhjkljejjjkdbcb____egmlecbilkknkjicflnllnlknlg`_^_bjlihd]ZZafilihikjeadgbdda]VPONNOPPRRQKB8888888888887777778888888;ACFGHHHFFEDDDDDDDDDEFHILLLTWWXYY]abcc__^\]]ZYZYYURNNNONNNR[dkihc`a_]\]\^djkf^^^]`a`egjknonkfknkkkkmjdfllkg`a`_binomfddddflkkjig___^bebdgginoleab`]UUUWZ[_dcaba]\]]]bgg`VRLJHCA?>>>>>==<;7/,"""""##%,/////00~~~022235:;;;:7/"$"$~$$%%%%,/68>@BIHF?=<;70/-*($$$$$$$##########&&&&%%%$&*-//0003~~<ACCCCCDEFGLOTZaca_YVTSNNNNNNPSSNNOQUVVWVVQOHGEC=<;::94,)%%%%&'(+/011113~8AJPYaeimmnolecbijkooooonihiihinnja_]\WOLKID<22/.!!"~###$&(/1689<FOXadda_`_[ZZZYWVWURQQQMFFEEEBBB@@@@@ACEJKPQQQOOPPSTTVUSSV^ehgaXOKIHHHJNUWVUV]bade^YXVVUUU\_gic``fhhcacjjeadfabcd`XWWZcg`\[[[\XVVUTSSRRSSTXXVTQONNMMNOSUUVV]`^^`_b``gijhb^^``fllecbilihikknnlebegdbba]TRPJHFA>>>>>>>>>>>?@@BCEJKOPQQRRSTWZZWRPONOPOPRTY^egmlec\SI@???=;;95444444444444555555?FJJJJKPV~WYYXYYZ[]`ebehcehejmkjg```aaekjiecikf^]\\[\\[^gmkkoonjcehgilia[YSPPPVY`bggb^\[XYX[[WUQQQUVXXZ\`^^YUTOLLLORQPOOPOPQRTW__XVVVVVVYbecfdbea^]YWWZ[ZZZXX\\[[[[]^]^[XWVQPOOOLLLLLLLKIHHHHHJNOQY]digb__dca`ZYWWVTSSUUSTUU[\YTRRTUVX]bceiigfea[[YWVW_cd_``bdhcacjjcaa`ghebea^`^ZZ_`ab_^aikkoonjif`]VSSSTTUUTTRRSSTTSSSRPMHGGGFGGGGFFFEB?;:88876655555554444444444443333333333321/,(
   6.674 +p                               $&((*+/48;=>CGLPTWYYZZ_cfghlnoprssssuuvuvv{~~~~~~~~~~~~~~~~~~~~~~}}{yxxy{}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}xwwvvvxxxxxyyzzzzzyyyyxxyyz~~~~~~~~~zzxxxxyzzzzz{{{{{yvvtqqqqpqppppponnnnopqtuvvw|~~~~~~~~~~~~~~~~~~~~~~~~~}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|zzzzyyxxxvvusoonnnnnnoooooptwxyyywwwxyyy{||}}}{xttrrpponjjjjiiiiijjjjklpuz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}xtojfa`^[ZYVRNIHHHHHHHHGGGEEEEEEEEDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDEEEEFFGIKLOQRVZ]_``abbccccddeeefffhhiinswz}~~}}}{{|||~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{{yvvtqnie`[VUTPLLKKKKKKKJJJHHHHHHGGFEB>=;8866666666555554455544444444444~~~44444444444444444~444444444444444444433110.-,,+++++++++++++++++++++++035777889~~999999999::;;<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<;;;;;;;;;;;;;;;;;<<<<==>~CHMQV[`dinsw{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vqqolgjl~mmnrw|~~~~~~~~~~~{vqpokkifb^]]\[ZZZYWVVVVVUUUUUUUUUUUUVVVVVVVVWWWXXXXYZ[[[\\\[[[\\\]^^^^_bcdgiijkkmmnnswy{{{|~~~~~~~~~~~~~~~~}yxxxxwvsssrrqppommmlllllllllkkkkkkkloqrssssssttttuy}~~~~~~~~~~~~~~~~~~~~~~~~~~~|xwurnjigd`[WVUUUUUUUUUUUUUUUUUUUUUUUUUUVVVVVVVVVVWYY^bfhijjjjjihgggfddb`__________________bdddeefjn~qsttuvwx|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~||{yxwwwxxyz||}|||zzywvvwwwuuuvvw|~~~~~~~~~~~~~~~~~~||zwwuuuvvuuutttttssssssrrqqpnnnnnnoooooooooooooqrrsw{~~~~~~~~~~}|{zywwwwwwwxxyyyxxxzzz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vrmhc_ZUTTTTTSSSRRRRRRQQQPNKFFEEEDDDDDCCB@<876555332222222221111111111111111000000/-)%
   6.675 +p                               :?DHMRVXZ[_befcacada^^a`cd]]^\Z[ZYUSRRRSUW`fhmkca`_^``_cjhgcdgdghdfa^^bhhaXXXWY[_`achhhccbilmge_^^^aikecbhhcegcehigfecekkecge^\Z[ZZZ[\_dc`bekicegghic_^\WWXWVWXXWWWWVWWUUTRRRQQQSSTW]`___ehdbd`affdddbd_YZ]eidaccad`[[bee_XXYY[bcbhlnnhf`\\[Z[^ZZZZZ_^__``bb`_^\^\[[Z[^][\[\\\^ZRRRRRY[`hlgeda`_bjnlfcfcekmnni`]^]_`_edaelmlg``_[[\ZZ\]cb`ba`fdaddbea_`cknlebaagiejhggechhcdc^^__cgejmoooolfcheadfeedginooonmjfkkkmh`a^^bfcZWVVZZ\[ZYYXWXXVRKB?>====>>?@@ACELNSTUX]]^[WVUSPOOOPQQQRSTSSRQRTUUX[[\\[WWYY]^aihbccafdad`bddcimnkcZWUTTTVWUVW]ahlnnjb_`ekmnkkliejnolfcfc_`_^_aghjdacbbcddbaimhga^]_^a^\]^_bjnollnllnjcefcfebba`fgkgc_^``gjjljehdabafed_``bba`ghhike\YWVVUU\]abahjiie^]]\^ahg_ZYYWX[_ejihilkebdgc``_[XVVTTUWW]`fd]SJ@>64-******''&&&&&&&&&(*,.8?AHKKKLMNONNLKKNNMMIIHHGGGHHHHHGFFFHKKLNOOPOOOQRXZ]__^ailh`]\]`eb_^\]^_fidba`dlnkkkjjeiieknjieciicflnonkjib\]~~~~~~~~~~~~~~~~~~~~~dea^^bjnnkc`YY`biieikeaa\VSMMLLLMMMMNOR[djhfaYWVTUW]^cedba`^YPG>;420*('''(*0144<??@=6-~~*(#%&'(((*-6?EFIS\elnmiaWVUQIGA8775533321+)))~~~~~~~~~'&&&&%%%$$$,5:;=>@BCEEHMORR\dhhggdbdcdabc`XPOPRVVWXY\^VMJHB90-+*)%$$$"""###########~&09@BBKT]beklihjnkkmh_\[Z[]_ddglkcZWVQONLLKG?=;:9~42!!!!""""""""##$$$$$$$$$$$$$$$$$$$$$%%&&''(*,--..//000000001114<ABCFFFFFFMOPX[ZVTRQQRX`dbdcfiknlf]\[[\]^a`hjebd`bdijnomhfea_`chg``cknole`bde^[[ZYY[Z[][VSRPPPONNNMNPTXZ[]dd^\\[\\^ehif`[ZZYYUUWXZbd`bca_`ahheijf^[YXWVSQONMLKKLKHHHHGGGFFFDDCA@@?@@@ABCEEFFFFFGHHHILRU\^^bec\SMFFEEEECCCCCCFOTUTSRRQQQQPPSSY[[^]ZZ[~^cdca]^[[]]\]^XX\dhb^^a`_^]\^^ceecilg^\ZYVVWY]cc__cimkfjihimjc`b_[[ZZ\[ZTQJIIIJJKNQS\aa_`_cc__]ZYYYYYWWW]ejmoonkca`__^a__YWUTSSVZXPLJIHHHGD?=<752+%#""######$$&,-0024445566666777777@EHIKMU[[[\\_bdc_WWXXZYY_aeabaekjca^__^^acccacfefdba\YZcjlha`^]]YVVYbhecjmonkkjc`bb__cdfjecjmihejlfdb^XVOOOOPUY_^\\YYYWVQOOPPOPPPQRQPPOONNNNMMMOQVWVXWW\^ahjjecikeaaZXQNNNNNRSSTTVVUTOM
   6.676 +p                               9>BGLPTWYZ^befgghhiiijkknoprssstttsssstttuz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zxuuttttuuuuuuuvvuuutttttuxyz}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|{zzz{}}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~||}}|yvuuvuvvuuutsssrqnjiiiiiiiiiiijjkmoopptwxxxxxwvtssstttuvvvvvvvvyzz}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|yuqpnnmmmmmmljgb^YTTRQQQQQQPPPPPPPPPPPPQQRRRRRRRRRRRRRRRRRSSSSSSSSSSSSSSSSSSTTTVWXYZZ[[[\]]_`dfhilnopppppssttttuww|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zyxyxyzz}~~~~~~~~~~~}~}~~~~~~~~~|xsnje`[[ZZXUUUVVVVVVVVVVVVV~~VVVWXXXXXXY^cgkoqrrrrqpnjigd``^[ZZZYYYXXXWWVV~~~~~~~~~VTTSSSSSSSSUUUVVVVWWYY\]]_`ejnswy{|~~~~~~~~zzzzzzyvrrpmiddb_[VUUTSRRRRRSTTTTTUUUUVW~[`dgijnsx}~~~~~~~~~~~~~~~~~~~|ytpkfb]XWWVURNJEDDC~B?;;;;;;;;;;;;;;;;;;;;;;;:::99999999999999999999999999999999::::=???@@AAAABCCCDDDDDDDEHKLLNOTX[]^____`bcdefjlmnpquz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{|{{}~~~~~~}||zxxxx|~~~}}}{{{{{{|~~~~~|||||||~~~~~~~~~~~~~~||{xuplkkjhfb]\[ZZZZYYYXVVTRQQQQPOOOOOOOOOOOOOOOOOOOOOOPPQRRRSSSSSSSSSSSSSSSSTTUY[\]]]^^^^^^^_`aabbcccd~hkmnooooprssuuuvz}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}{xxvvvvusokjjjjjknoprttuuuvwwwwwwwwxxwxx}~~~~~~~}xsnjedbb`^^\ZYYXWUQPPPOOOOMMMMLJGCCCCCCCCCCCCCDDDDDDDDDDDDDEEEEFFFGJLMNOPTVWWYZ]_`aaaabbbccgijkmnrvz|}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}zvrmhhfeeeeeeeeedddddddddddddddddddddddddddddddeffgghkmnooonnnmlihgda\[[[ZZZZYYYXWURN
   6.677 +
   6.678 +a
   6.679 +s chickenMito 5978 156 + 16775 ACCCTCCTCTCCCTAGCTGGCCTCCCACCATTAACCGGCTTCATGCCAAAATGACTCATTATCCAAGAACTAACCAAACAAGAAATAACCCCAATAGCCACAATCATCACAATACTATCACTCCTAAGCCTATTCTTCTACCTCCGACTTGCATAC
   6.680 +s humanMito   5208 156 + 16571 ACCCTCCTCTCCCTAGGAGGCCTGCCCCCGCTAACCGGCTTTTTGCCCAAATGGGCCATTATCGAAGAATTCACAAAAAACAATAGCCTCATCATCCCCACCATCATAGCCACCATCACCCTCCTTAACCTCTACTTCTACCTACGCCTAATCTAC
   6.681 +s mouseMito   4651 156 + 16299 ATATTACTATCCCTAGGAGGCCTTCCACCACTAACAGGATTCTTACCAAAATGAATTATCATCACAGAACTTATAAAAAACAACTGTCTAATTATAGCAACACTCATAGCAATAATAGCTCTACTAAACCTATTCTTTTATACTCGCCTAATTTAT
   6.682 +s fuguMito    4748 156 + 16447 ATCCTTCTGTCATTAGGAGGTTTACCCCCACTAACTGGCTTCATGCCTAAATGACTTATCCTTCAAGAACTTACAAAACAAGACCTAGGCATAACAGCCACATTAGCAGCCCTTAGCGCCCTACTAAGTCTTTATTTCTATCTACGCCTATCCTAC
   6.683 +p                              YYYZ\^bfdhhhinollnkkihd``_^_abhmjidbdc``^]^_]\[Z[]_b^ZXYY\\[]^^[[afca[[[a`baabceida[[`_bebddbdaZXWVVVTU^glnmg^\\[Z\\XXZZ_b`ca_`cgfea`_a]ZYXVPOOOV]agmjieadgc
   6.684 +p                              IIIJKLOQRW\`ejosx}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zyyz|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}~~}}~~~~~~~~~~~~~~~~~~~~~}zyyz~~~~~~~~~~~~
   6.685 +p                              ~~~~~~~~~~~~~~~~baeghgc[ZZY\]\]afhjjkkjb`]^bf`][\]^`[XWX^gjknlebdcaYTLICB@99865543333333333337889:;>>>HPSTSONMJHFFFFFFGGJQS[[YYY`adaa`giknonkjhbcd^^[UTSSVVU
   6.686 +p                              %*/48=BGKPUY]`abbchlprttvwxyzz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|xwuutqqomihgfffeeeeeeeefghhimpqrrssssrppppooooppprsw|~~~~~~~~~~~~~~~~~~~~~~}{xwvsrrrsss
   6.687 +p                              RTVWYX[``c`^^bikklgd^]__aaabbcimjiecghib`]^bhdb`ccc`XTRRSTTTSSSU\_c`YPPNMLHFECAAA@@====>>??????????@??@@@@@CIKKKKKMNPPVX\]\\YWWVX\^]_a__``^ZVUSPLHC>950//.,*
   6.688 +p                              TUX[\]_``bccdhmquwxxxxz{~~~~~~~~~~~~~~~~~~~~~~~~~~~|xssrrsssssstvwxxwvuuttrokgba___^^^^^^^^^^^^^______________________```_______^^^^^^]]\[XUQPNKGB>94/+*))'$
   6.689 +
   6.690 +a
   6.691 +s chickenMito 6279 228 + 16775 AGAAACTTAGGATTAACTGTCACCAAACCAAAGGCCTTCAAAGCCTTAAATAAGAGTTAAACTCTCTTAGTTTCTGC-CCAACTAAGACCAACAGGACATTAACCTGTATCTCCTGAATGCAAATCAGACGCTTTAATTAAGCTAAGGCCTCTAC-CTAGACAGATGGGCTTCGATCCCATACAATTTTAGTTAACAGCTAAATGCCAACACC-AATTGGCTTCTGCCTAC
   6.692 +s humanMito   5512 219 + 16571 AGAAATTTAGGTTAAA-----TACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAA---TACTTAATTTCTGCAACAGCTAAGGACTGCAAAACCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAG--CCCTTA-CTAGACCAATGGGACTTAAACCCACAAACACTTAGTTAACAGCTAAGCACCCTAATC-AACTGGCTTCAATCTAC
   6.693 +s mouseMito   4949 211 + 16299 AGAAGTTTAGGATATA-----CT-AGTCCGCGAGCCTTCAAAGCCCTAAGAAAACACACA---AGTTTAACTTCTGA------TAAGGACTGTAAGACTTCATCCTACATCTATTGAATGCAAATCAATTGCTTTAATTAAGCTAAG--ACCTCAACTAGATTGGCAGGAATTAAACCTACGAAAATTTAGTTAACAGCTAAATACCCTATT---ACTGGCTTCAATCTAC
   6.694 +s fuguMito    5059 218 + 16447 AGAGACTTAGGTTAAC-----ACCAGACCAAGAGCCTTCAAAGCTCTCAGTGGAAGTGAA---AATCT---TTCAGTCCCTGATAAGACTTGCAAGCCATTATCTCACATCTTCTGCATGCAAAACAGACACTTTAATTAAGCTAAA--GCCTTAACTAGATAGACAGGCCTCGATCCTGCAAACTCTTAGTTAACAGCTAAGCGCCCAAAACCAACGAGCTTCCATCTAA
   6.695 +p                              5<>??GJJHA=53.+*~~~~~$"".57<=?BKSYaeijmhfe^URLC?>91.'%%$$$$$~~~$$$$$$$$$$$$#"$$$$#".1:ADNW`daa`_a`]]_^XX\abimmibcbekihejmjhilh`[ZZ\afghjjjifd^UKB?8~~/..,%""/8BIKKLLLMNQVXZadfffdbafc[[[Z^^`cknkkkkooomh_YPPOLJE=4+((~(+4>GPZbhmllnkihb
   6.696 +p                              KLLLLLLLLLLLLLLL~~~~~LLLNOPQRRSX\`ceffffffedb_[VUSPPNKKJJJJJ~~~JJJJJJJJJJJJJHHHHHHHMQV[_dgijklmmnnnopqqruvw{~~~~~~~~~~~~~~~~~~~{zz{~~~~~~~~~~~~~zup~~lkifba_``````````aehjkpty}~~~~~~~~~~~~~~~~~~~~~~~~~~|wwvvtqniddb~bgkpuz~~~~~~~~~~~
   6.697 +p                              ^VMJHBBB?96/..-+"%+-+"%,/00123468AJPX[cdcc`WTOMGE@>7.,)(((('"$'"%+-.........+##*--7@GINNPRSUXYXXYYWVVVUU]cfdihe`_ckmjhekmjhjnomhabbghhijjjjge^TKA:1!!!!"$%(~09BIKMNNRTSRQMMMMNPQVWWVUTRRQQSUXaijjihe`\WRMIDCCCBBBBBBB~AAAA@?=:51,++++*)
   6.698 +p                              NNNNNNNNNNMLKJJIHHHHHHHKMNRVXYZZZ]^^^^^^^^^]ZWVUTSSRPMIHHHHHHHHHHJKLLLLLLLLLLLMNOOQQQQQQQQQQQRRRRRRRRSSTXZ\\_aabcglpsuvz~~~~~~~~~~~~~~~~~~~~~|wsnid``aaccdd~imqstuuuxyyyxvvvvvvvwwwvttssrqqrrrqpmie`[WRMHC?>>===<<<<<~<<<;;:840+'&&&%%#
   6.699 +p                              %'(()*17<ADGIIII~~~~~IJOTY^bfhjmnnkkkklfd_VLIHEA90-&$$$$$$$$~~~$$#"!%#"()****++0244:;;;;;;;;;;;;::::::::::;?HQUVW[_c`abikebaahljcfklged`]WTMKD;1'%#~~#####!!1:CJLLLLQQSVVVWXWWXXYYY[befgheijkookkkknnjaXNLD;2/-,'%#"!!-/112;DJKIGGFA8/,
   6.700 +p                              $&((*+049=ADEFFF~~~~~GGLQVZ_cgijjkkjjihea]XSNNLIE@;765555555~~~55555555566666666666666666677777777777777778;>@@@AEGHIKKPUY\]^beghmrv{~~~~~~~~~~~~yu~~tssqnkfhiiiiiiiijjkllmmmmooqqqrw{~~~~~~~~~~~~~~~~~~~~}ytsqnjigddbcdddeeffffffeedb_
   6.701 +
   6.702 +a
   6.703 +s chickenMito 6510 2477 + 16775 CCCCGGCACACTTTAGTGTACATCAACGAGTTTGCAACTCATTATGAACTTCACTACAGAGT---CGATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTTCAACAC--TCAGCCATCTTACCTG--------TGACCTTCATCAACCGATGATTATTCTCAACCAACCACAAAGACATTGGCACTCTTTACCTAATTTTCGGCACATGGGCGGGCATAGCCGGCACAGCACTTAGCCTTCTAATTCGCGCAGAACTAGGACAGCCCGGAACTCTCTTAGGAGACGATCAAATTTACAATGTAATCGTCACAGCCCATGCTTTCGTCATAATCTTCTTTATAGTTATACCCATCATGATCGGTGGCTTCGGAAACTGACTAGTCCCACTTATAATCGGTGCCCCAGACATAGCATTCCCCCGCATAAATAACATAAGCTTCTGACTCCTCCCTCCCTCCTTCCTTCTCCTACTAGCCTCATCTACCGTAGAAGCTGGGGCCGGCACAGGATGGACAGTTTACCCCCCTTTAGCCGGCAACCTAGCCCACGCTGGCGCATCAGTAGACCTAGCCATCTTTCATT---ACTTAGCAGGTGTTTCCTCCATTCTAGGAGCCATCAACTTTATCACTACCATCATCAACATAAAACCCCCCGCACTGTCACAATACCAAACACCCCTATTCGTATGATCCGTCCTCATTACTGCCATCCTACTACTCCTCTCCTTACCCGTCCTAGCAGCTGGGATTACCATACTACTTACCGACCGCAACCTTAACACCACATTCTTCGACCCAGCTGGAGGAGGAGACCCAATCCTATACCAACACCTATTCTGATTCTTCGGTCACCCCGAAGTTTACATCCTCATCCTCCCAGGTTTCGGAATAATTTCCCACGTAGTAGCATACTATGCAGGAAAAAAAGAACCATTCGGATACATAGGAATAGTCTGAGCCATACTGTCAATCGGATTCCTTGGCTTCATTGTATGAGCCCACCATATATTCACAGTCCGAATGGACGTAGACACCCGAGCCTACTTTACATCAGCCACAATAATCATCGCCATCCCAACTGGTATTAAAGTCTTCAGCTGACTAGCAACCCTGCACGGAGGAACAATTAAATGAGACCCCCCTATGCTATGAGCCCTAGGATTCATCTTCCTCTTCACTATCGGAGGCCTAACGGGAATCGTCCTTGCTAACTCATCACTAGATATTGCCCTTCATGACACCTACTATGTAGTCGCCCACTTCCACTATGTCCTCTCAATGGGGGCAGTTTTTGCCATTCTAGCAGGATTTACCCACTGATTTCCCCTCTTCACAGGCTTTACCCTACACCCATCATGAACCAAGGCACATTTCGGAGTAATATTTACCGGAGTTAACCTAACCTTTTTCCCCCAACATTTCCTGGGCCTAGCTGGAATACCCCGACGATACTCAGATTACCCAGACGCCTACACACTATGAAACACACTATCCTCAATCGGCTCCTTAATTTCAATAACAGCCGTAATCATACTCATATTCATCGTCTGAGAAGCCTTCTCAGCAAAACGAAAAGTACTCCAACCCGAATTAACTGCCACTAATATCGAATGAATTCATGGCTGCCCACCCCCATACCACACCTTCGAAGAACCAGCCTTTGT---------ACAA---GTGCAAGAAAGGAAGGAATCGAACCCTCACATGTTGGTTTCAAGCCAACCGCATCAAACCACTTAATGCTTCTTTCT-----TATGAGACGTTAG-TAAACCAATTACATAGACCTGTCAAGACTAAATCACAG-GTGCAAACCC-------TGTACATCTCATATGGCCAACCACTCCCAACTAGGCTTTCAAGACGCCTCATCCCCCATCATAGAAGAGCTCGTTGAATTCCACGACCACGCCCTGATAGTCGCACTAGCAATTTGCAGCTTAGTACTCTACCTTCTAACTCTTATACTTATAGAAAAACTATC---ATCAAACACCGTAGATGCCCAAGAAGTTGAACTAATCTGAACCATCCTACCCGCTATTGTCCTAGTCCTGCTTGCCCTCCCCTCCCTCCAAATCCTCTACATAATAGACGAAATCGACGAACCTGATCTCACCCTAAAAGCCATCGGACACCAATGATACTGAACCTATGAATACACAGACTTCAAGGACCTCTCATTTGACTCCTACATAACCCCAACAACAGACCTCCCCCTAGGCCACTTCCGCCTACTAGAAGTCGACCATCGCATTGTAATCCCCATAGAATCCCCCATTCGAGTAATCATCACCGCTGATGACGTCCTCCACTCATGAGCCGTACCCGCCCTCGGGGTAAAAACAGACGCAATCCCTGGACGACTAAATCAAACCTCCTTCATCACCACTCGACCAGGAGTGTTTTACGGACAATGCTCAGAAATCTGCGGAGCTAACCACAGCTACATACCCATTGTAGTAGAGTCTACCCCCCTAAAACACTTTGAA
   6.704 +s humanMito   5764 2482 + 16571 CCCCGGCAGGTTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAATCACCTCGGAGC---TGGTAAAAAGAGGCCT--AACCCCTGTCTTTAGATTTACAGTCCAATGCTTCA---C--TCAGCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGACATTGGAACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCTCTAAGCCTCCTTATTCGAGCCGAGCTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCACATCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGCTTTGGCAACTGACTAGTTCCCCTAATAATCGGTGCCCCCGATATGGCGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCTGCTCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTACCCTCCCTTAGCAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCTAGCAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATCAATATAAAACCCCCTGCCATAACCCAATACCAAACGCCCCTCTTCGTCTGATCCGTCCTAATCACAGCAGTCCTACTTCTCCTATCTCTCCCAGTCCTAGCTGCTGGCATCACTATACTACTAACAGACCGCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTATACCAACACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATCCTACCAGGCTTCGGAATAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGATACATAGGTATGGTCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGGAATAGACGTAGACACACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACTACGTTGTAGCTCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATCATAGGAGGCTTCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGACCAAACCTACGCCAAAATCCATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACACTTTCTCGGCCTATCCGGAATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAACATCCTATCATCTGTAGGCTCATTCATTTCTCTAACAGCAGTAATATTAATAATTTTCATGATTTGAGAAGCCTTCGCTTCGAAGCGAAAAGTCCTAATAGTAGAAGAACCCTCCATAAACCTGGAGTGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACAT---------AAAATCTAGACAaaaaaggaaggaatcgaaccccccaaagctggtttcaagccaaccccatggcctccatgact-----ttttc-----AAAAAGGTATTAG-AAAAACCATTTCATAACTTTGTCAAAGTTAAATTATAG-G-CTAAATCC-------TATATATCTTA-ATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCTATCATAGAAGAGCTTATCACCTTTCATGATCACGCCCTCATAATCATTTTCCTTATCTGCTTCCTAGTCCTGTATGCCCTTTTCCTAACACTCACAACAAAACTAACTAATACTAACATCTCAGACGCTCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCTAGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTACATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAATCAATTGGCCACCAATGGTACTGAACCTACGAGTACACCGACTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAGAACCAGGCGACCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCCGATTGAAGCCCCCATTCGTATAATAATTACATCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAGGCTTAAAAACAGATGCAATTCCCGGACGTCTAAACCAAACCACTTTCACCGCTACACGACCGGGGGTATACTACGGTCAATGCTCTGAAATCTGTGGAGCAAACCACAGTTTCATGCCCATCGTCCTAGAATTAATTCCCCTAAAAATCTTTGAA
   6.705 +s mouseMito   5194 2478 + 16299 TCTTAGTAGAGATTTCTCTACACCTTCGAATTTGCAATTCGACATGAATATCACCTTAAGACCTCTGGTAAAAAGAGGATTTAAACCTCTGTGTTTAGATTTACAGTCTAATGCTT-A---C--TCAGCCATTTTACCT-----------ATGTTCATTAATCGTTGATTATTCTCAACCAATCACAAAGATATCGGAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAGCATCTGTTCTGATTCTTTGGGCACCCAGAAGTTTATATTCTTATCCTCCCAGGATTTGGAATTATTTCACATGTAGTTACTTACTACTCCGGAAAAAAAGAACCTTTCGGCTATATAGGAATAGTATGAGCAATAATGTCTATTGGCTTTCTAGGCTTTATTGTATGAGCCCACCACATATTCACAGTAGGATTAGATGTAGACACACGAGCTTACTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAGAAGTAATATCAGTATCGTATGCTTCAACAAATTTAGAATGACTTCATGGCTGCCCTCCACCATATCACACATTCGAGGAACCAACCTATGT---------AAAAGTAAAAtaagaaaggaaggaatcgaaccccctaaaattggtttcaagccaatctcatatcctatatgtct-----ttctc-----AATAAGATATTAGTAAAATCAATTACATAACTTTGTCAAAGTTAAATTATAGAT-CAATAATC-------TATATATCTTATATGGCCTACCCATTCCAACTTGGTCTACAAGACGCCACATCCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTACCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTCGTTCTGCCAATAGAACTTCCAATCCGTATATTAATTTCATCTGAAGACGTCCTCCACTCATGAGCAGTCCCCTCCCTAGGACTTAAAACTGATGCCATCCCAGGCCGACTAAATCAAGCAACAGTAACATCAAACCGACCAGGGTTATTCTATGGCCAATGCTCTGAAATTTGTGGATCTAACCATAGCTTTATGCCCATTGTCCTAGAAATGGTTCCACTAAAATATTTCGAA
   6.706 +s fuguMito    5313 2494 + 16447 CCCCGGCAGACGTCAATCTGCTTCTTTAGATATGCAATCTAACATGTAA--CACCCCAGGGC---TGATAGAAAGAGGACTTAAACCTCTGTATATGGGGCTACAAACCACCGCTTAA---CCCTCAGCCATTCTACCTGTGGCAATCACA-----------CGCTGATTTTTCTCAACCAATCACAAAGATATCGGCACCCTATACCTAGTTTTTGGTGCCTGAGCCGGAATAGTAGGCACAGCACTAAGTCTTCTTATTCGGGCCGAACTCAGTCAACCCGGCGCACTCTTGGGCGATGACCAGATCTACAATGTAATCGTTACAGCCCATGCATTCGTAATGATTTTCTTTATAGTAATACCAATCATGATTGGAGGCTTTGGGAACTGATTAATCCCACTTATAATCGGAGCCCCAGACATGGCCTTCCCCCGAATGAACAACATAAGCTTCTGACTGCTTCCCCCAtccttcctccttctgctcGCATCCTCTGGAGTAGAAGCCGGAGCGGGTACGGGCTGAACTGTTTACCCACCCCTAGCAGGAAATCTTGCCCACGCAGGGGCTTCTGTAGACCTCACCATCTTCTCTCTTCATCTTGCAGGGGTCTCCTCTATTCTAGGGGCAATCAACTTCATCACAACCATCATTAACATGAAGCCCCCAGCAATCTCACAATACCAAACACCTCTTTTCGTGTGAGCCGTTTTAATTACTGCTGTACTTCTCCTGCTCTCCCTTCCAGTCCTTGCAGCAGGGATTACAATACTTCTCACTGACCGAAACCTAAATACAACCTTCTTTgacccagcaggaggaggagaccccATCTTGTACCAACACTTATTCTGATTCTTTGGACACCCTGAAGTCTACATTCTAATTCTCCCTGGCTTCGGAATAATTTCACACATCGTAGCCTACTACTCGGGCAAAAAAGAACCATTCGGCTACATGGGCATGGTCTGAGCCATAATGGCCATCGGTCTTCTTGGTTTTATTGTATGAGCCCACCACATGTTTACAGTCGGCATGGACGTAGACACCCGAGCCTACTTTACCTCTGCCACAATAATTATTGCCATCCCGACAGGAGTCAAAGTATTTAGCTGACTTGCAACCTTGCATGGAGGATCAATTAAATGAGAAACCCCTATACTATGAGCCCTCGGCTTCATCTTCCTATTTACAGTGGGTGGCCTAACCGGAATTGTCCTAGCCAATTCATCCCTAGACATCGTATTACACGACACCTACTACGTAGTTGCCCATTTCCACTACGTCCTCTCCATGGGTGCTGTATTTGCAATTATGGGTGCATTCGTACACTGATTCCCACTATTTTCAGGATACACACTCCACAGCACTTGAACTAAAATCCACTTCGGAGTAATGTTCATTGGTGTCAACCTAACCTTCTTCCCTCAACACTTCCTTGGTCTAGCTGGAATACCTCGACGATACTCCGACTACCCCGACGCCTACGCCCTATGAAACTCCGTCTCCTCAATTGGCTCAATAGTCTCTCTAGTGGCAGTAATTATGTTCCTCTTTATCCTCTGAGAAGCCTTCACCGCTAAGCGAGAAGTCCAATCAGTTGAACTAACAATGACAAATGTAGAATGACTACACGGGTGCCCTCCTCCTTACCACACATTCGAAGAGCCCGCCTTTGTCCAAACTCAAACCTCTATCCGAGAAAGGGAGGAATCGAACCCCCGTAAACTGGTTTCAAGCCAGCTACAAAACCACTCTGTCA-----CTTTCTTCATAAGACTCTAGTAA-AATGGCAATTACACTACTTTGTCAAGGTAGAATTGTGG-G-TTAAACCCCCACGTGTCTTATTATTA-ATGGCACATCCTTCACAACTAGGGTTTCAAGATGCAGCTTCACCAGTAATAGAAGAACTCCTTCACTTCCACGACCATGCTCTAATAATCGTATTCCTTATTAGCACATTAGTACTTTACATTATTGTTGCTATAGTCTCCACCAAACTAACTAACAAGTACATTCTAGACTCTCAAGAGATTGAAATTATCTGAACTATCCTACCAGCTATTATTCTTATCCTCATTGCCCTCCCTTCCCTCCGAATTCTTTACCTAATAGACGAAATCAACGACCCCCATCTAACAATTAAAGCTATAGGTCACCAATGATACTGAAGCTATGAATATACAGACTATAGCGACCTAGCCTTTGACTCATACATAGTCCCCACACAAGACCTGGCCCCCGGCCAATTCCGCCTTTTAGAAACTGACCATCGAATGGTCGTTCCAGTGGACTCCCCCATTCGAATCCTAGTCTCAGCAGAAGATGTCCTCCACTCCTGAGCCGTCCCCTCTCTAGGTGTAAAAATGGATGCCGTACCCGGCCGTCTAAACCAAACAGCCTTTATCCTGTCCCGACCTGGTGTTTTCTACGGCCAATGCTCTGAAATCTGCGGAGCTAACCACAGCTTCATACCAATCGTTGTTGAAGCCGTCCCCCTAGAACACTTTGAA
   6.707 +p                               VVUUUURPNKJJJJKLOW\]_]]afhmnkkihinokkkjhbbbgif][TSQKC:6.(%$#"!#"!/8@EKLKKGEC=5,)'%%(*/00249:<>EHQY[cghnnkd[QNMKF>4+(&+~~~4~~>GQZ`a^VOG>41/*+4<???<410*+4<BDEEEFGHIQWZ`dgcflkkmlhbc_]^__bimihimiehecghihdabcbccaejicflkknigdhecjnomibbdcab__b_`bbhiejiejljie\[ZWVVVY`cknolebda]]^]^_^`a`eff^WSRQQUWXX_fca[Z^`gljhdaddaelnihejkkooonjcehejihinonhaabdicacjihdacekkkoooooollnkc`_aebekjiecgimkknihhgfaceloooleab\YYYYaikknllonihehdba``glmlicdd\YXVWWW^cadjgfecfedikjjg___^cknmjcacgec`_][[YTSTTTUUUUUVVVWY[cghgc\\a`dkmlh`a`_adbginoookkkknnigcflkkooooookda`[YWUUZ`_XTRPMLKFEEFHMOQUVWXZadklfchecjnooollnihc`bc`bdie\ZXXXad__cjmjdec`bbabbbhjkkeabdidb`cb`bdbefca``edbeb`bebdhjnonigdhg`aacdcbcdcjkknnjidaddbggbegghgba`_cebbaahmooooolkmh``_^_``ghgeb^_][[\[[[ZZ[ZZ\^`edggbcelmjdfmolfciiehjnmfd~~~~~~~~~~~~~~~~~~~~~~~~~~ccejg`]^^]^ahecbhgaabdjecgimkkkeb`dgb`_^afgjieiljiechhceheginonia^YYYY[[[djhffejkknjhimnnklnllonkjibcekhgbba`efgfa_`a_bb`dheaa`eb`ckkkooooookkjiecbbbcekihda[[[[`aaefcgkligbdfcehejnonjcdfbdgdhiceijkkkca_bjkebaeegkebffdglnlebejjihdhjiecbimnoonjhcackmkfknoonnnnnooonjcdc\\\\bcafdbgecgeciljifcjmonibc`]^^_gijigejmnjhjnonjhjnooooolfcgc`bcadgcekligb_`afhmlecffhnoonjgaaadb[[aagheinnkca_bige`_]YXRIHHHHHHNOQWYZbdbghligcehcedbeebeijkd`bdf`_^_bjnoolebdecjmoooonkeiecimnmhdffdjmonjehecimnlebdfabeijnooonkdadknookjibcelmjdffcefhkfdjnooolfchgfa`^]^dfmoonjbXVTTTTUX`ba`djnkklfcilihjnnkf_^^]``^_ZY[VTTTTTUVY__bdfbbbimooonkkjdfcffdjkdb`[[chihbceljjhffdijjibYYYY[_^`bfgd`ccafhjjibba`dlnmjdfmnnjdfloolebaahmonjdflnnkknooonigfe^UUVYZ\^_diheilihekmlecbhhhhiejmklnonibc]YYYUUVWZ^]_^Z[[[cfbeggimmjcacghecbimkjg````gid`bdg`\[\ZXX]_^ZSQOOPPPQQRSSTVYYZZZ\]aaahmnja\\chihejkdb`_adiecbhhcfkmmnnllnjc`bdc^ZTSSSTTTV[~~~~~~~~~ZYXWSQQRSTUWXW\]`fgjjkkkkoonihb`_^]\]]\[]afhhhinllnkjge___bge``efe``ehiegd~~~~~b`_cg~~~~~ca]^^]WTMDB:1!!!"""##%''(1;DKNW\^`innjhilfd^\ZTQKB9/""~$$%%+,/7~~~~~~~?CDDDDC=41*'*38:<<<ABCFJKLMPUWY^_egmoooollooolfchhcefefhmlfcimnnlknoni`]^^XXVUUUUXbjnooljgbb`dgcejhgb__bbceffa^_^ZZ__YWWWZcknkgebcb`ZXWVVUTTT\egfcd`a`cjjkmhgghnnjgc\[ahhc[[Y[ZUUUV^egeihdfb`bca`bahhghhfbb`ekkkonkcacfbba`da^_badiec\ZZacaebddcgdadhdba`fdaekooonkc`bc`cecgihgejnnnjc``hlhfaXXUUUTRRQQRRUZ\\][[[ZZ[Z\`^_^]`hjjkklfdjnoonigcfloolfcggdgecjnniaXUTSRQQSUUTT\^\[[]^abaffcee`YVTTTSTVUSRRSU\agd`bdgfdffdgcachejnomjceechecjkknjdeecelnnkeiecgf`aa_aa_b][UTTUUUWXX[dkljcacggecbilkfa`ehmoonjb_aaelnoooooonkfjkdba`\ZYXYYUSLLLLMNPRZ\eknkc_`[XXXY]^^afdjlgeebca^\\[\^[[\[\[YYZVVTTYbhfd^]]]]`geciljdfebeijnoooooniggebelmkkjdfabeiiiehd\\\\eknjhilfciljhea\WRNMKJJJHFCB@;740,++++**)(
   6.708 +p                               hgfeeeeeeeeeeeeeefgghhinsw|~~~~~~~~~~~~~|{yyxurnihfc_[VQMLKKKKKKKPTWXYYZZZZZYYYXXXX]adfgkortuz~~~~~~~~~~~~~~~~|yuqlgcc~~~c~~dddccba^ZUPLGB=99999999999<>?@@@@@@@BCHMQUXZ[`dinqtvvy{{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|}||~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|yxwttsttxz{{{{}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{{{{{|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zzyxxxwwuqqppqqqrsuvvwxzz{z{|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|xwwwxyyy|~~~~~~~~~~~~}zzz{{}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{wrnimqstuvw{~~~~~~~~~~~~~~~~~~~~~~~~ytokfa\\~]]^^__`d~~~~~~~iloppppponkgijjkkjjkkkklllmprttvw|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}}|}|}}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~||{yxxy}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{xwwwyz}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}{z{z{}~~}}~~~~~~~~~~~~~~~}zyxwvtsssrqqrrw{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}{z{z{zyyzzzz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|wrqplhd_ZVQLKIIIHGEBA?<94/+***))(('
   6.709 +p                               (+.//000000000000012334556:=?@EJNSWZ[[_ba`cilia_]]`fd\YY_`cf`X~~~WZWWQHEECBA=5+('&&+2445566666789::<>HQVWTKHAA?8753.%"+%"/~~8?BBCCBBA@>7.+)#*---++)#*---.6;<=?FIQVZ\\bhhcelkkmlicda_`chinnjhjnoonkjhfabcbcbadjjie\YYY^aijjieilleacb\[YTTTRQQSY^dknonjegcacjigc`bb`chilidgebfdbhg``a`cjh`]WUTNNMMOONOQXZZXX`hlibcb`cdaelmihdgcackooooooonjhjnole\\\\dhcflkknnkklecbilmkdadjmjhjnoomjdflnihdgikdb`cc`bdlooooole\YYYY_`_bijkoollnldba``ffcffbef_]\[[\^`inomhffdginoolloolloooomib_`_bdjhfec\WW[acdcilkkjeiiceb_``[[`aa^_cc_``^ab`a`_bcaddbeklhf`aa_bjnlebdf`]\WWWWY\dha^]\XVUPMMMOUWZbcadkigdgecgecjnooleb[QKHB?83-*###"""#$$&)2<FOW]diieaehihb__YVVZbca`dijnoleb\\\\ekmlhaaa_adcimnigeikgedeb`_^^]_ZWW[Z[]\`ginnkkihhhdedefhehinnjfjnoollookjhbccbghcc\ZZchinnlfciljg`\\XTTVVWWXaikkoonkfknlecbgdbgecimnoonjb_abahmklonkkjiecgimnkkkecgimklooldba`fdbghmkknkknnjb_^]^``~~~~~~~~~~~~~~~~~~~~~~~cdflkloolebaahjkmihhhdfa_`a`hlkjibcekhfacelkkkknjieadffec]]^^dgebebekmibYY[[abcbaabcelkkkklecafhnooooonigbdfcfloooolfbdb\\aahmjiebeedghihd``_^__^edbffdglnlebejjknnnmkecbilnmha`chiicflooooomljebelnlecfd\\\\bcafdcgecfcacjkkooooolfciia_]\]_^a`^^__ddflicbaahnoooonjegc`bcadgcflia^XTTSSRSVY[acde^ZTRQRSSSVUV_fkiejnonjhjnollnlloonjb_]^_^acjib]]__cdcfhjjibde__`_`a`fc[YZZbeabeloooooooonmidfc`a^^adbhieknnlfdjmnmjdgdcggdgebelnkkkkoooooookjiejlkjg___^bgdgc_abdkjie]ZZbhechgfba`^`^^bimoonihhgffgheghieilkkjb__degimjdfa^\\\][[WVW[]ZXVUUU\beed^VTTTVW]cdba`cadgfdfa^_``didb[XXYX]^__^^cghhbYYYY[_^`bgilibbafhjjjdeeegmonjdflnnjcehceidba`giehebeca[SPPQZcjihgfc\[aimkebdd__bbgimlebeebdgffe``fiknnlfdjlheaYY\`_b`bb`bdkjd[[_^bjnnklnkkjid`a^^`^___gkhffhjd^^\WUUWWXZ^]\VTSSSTUYZZUUVWXY]]_a`gha]\ZZbhihejh`^\YYYWYZZcikklljecgimhedb\ULC996554333~~~~~~~~~211-"#%"#&.234579BILSU\_elnjb`YVTRRQQSTZ[^dfhgiiga_XUSME<22/-(%$###"""""""!!!!!!!!!!~~~~~#%%',--/18:?@~@@@@@@@BDEEOWZVONNPSZ][TQKKKKKJJHB?96/~,""$()*+,/~~~~~~~57:::::94,)%'(((((((((((+024:<?GLMMMMOQZacknke\XX\\^_^^^^flooooolknnlf^XVUSRSTYZZ^dciicflnnihijehhc\[TPPOOOOOOQVXY\aa^]]]`gig`_YVUSLLKLLLLKKLOPQTUYZXSPMKIHHHFDB>6-+"$("$*,.5778889BKPQRUU]`_ab`_`^^XUSSTW`glnjifcjmkkjeffhkfcfb_`fjkooonigbZY\\dgghkebaaghggf__]]ahihebeloonihejnonjc``ghcfkh`XVTRRSUY[\cca`b^_``_`_acbdebekjkkklfdjnoookkkkmkeiecillkecihaXOMGECCCCCDCCCDHIKMV`gjknmlf`XRPPQQQQUUVWXY[`b`YWVUVV_efebe`]^^`cadgceechechecijcadjibZY\\dhecgdba`gecihgcdccdflkkkc\\behhbdc^_^[[\[[^_fknnjb_aaelnoooooolecgd\\\\ZYXXYYYYXY\_``bdknnkfjkeb\YYYY`cknkfklhfebdgfgfd_^]_afe``_`_cdcgmlgd^^^]`a_^\]bilihejkkoonmjejihinomjehinnibceijnnmiaaahljeffhidaca]]^]\YUTQQQQQQQQQOLHC?:998740+'
   6.710 +p                               %(+,------------..//0022337;==BGLPTWYZ^acchlprssstvvwvvvvvvvvu~~~uutttsrqpnkfb]\\[[]^________________````````````__^[XTTTT~~TTTTTTTSSRRPNJFA@@@@@@@@BDDDEGHHHIKLPTWYZ^acdhmrvz}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}zyxutttttuy~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zz{~~~~~~~~~~~~~~~~~~~~~~~{vrmljgc_ZUPOOOOOOORTUZ^chmqvz}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|||{|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}yupooooopppqvz}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{yyxxwwwxyyxwvwwz}}}}{xwwwyz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vuspoooooopppppppqqqsstttuuuuwwz{|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zxuqlhc^YUPKJHHHGGGG~~~~~~~~~GGGGFFFGGHLOQRV[`einsx|~~~~~~~~~~||zyzyzyzyywtpkfb]XSOJE@<;9621100000000000000011111~~~~~1111222238;>@~ADFGGHIKLLMMMMMMMMNNNOOOOOOOOOOOOOOOON~NNNOOPPPPP~~~~~~~PPPPPPPPPPPPPPPPPPPPPPPQQSTXZ\]`bcdddfglquy}~~~~~~~~~~~~~~~~~~~~~~~~~~zuttssstwxy{}}~~~~~~~~~|wsrpmihfccbbbbbbbccccccccccccccbbba`_^]]]]]]]]]]]]]]]]]]]]\\\\\\\[YVRQOOOPPRSVYZZ[[[\`cdegiilmnpqrrrrsssssstx}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|yxxy|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|zwsnnlkkkkkkkkkklmnnotx}~~~~~~|wsrrrqqqqqpppppppppppprsw{}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{{{{}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}{yvusplhcba]]]\[XTTRQQQQQQPOMJFB=877752.*%
   6.711 +p                               abceijle_ZYY[]cddjmonihbYWTSSV[\_dd`]VPNLGEC>5+)'&&)--../0225<~~~@@AAA@@@@@@?;41+''')-../022233348:;>GOSTTTURQKHGA8/%%~~~"$",/8@DEEDA99641.&$######""""##########"*,-08=?DFKNVZ\]__]^__bimihimiegdbdd`ab`dknnnkkibYYXZZZ`aafecjnolecffdac`aglklnooonjejmkjh`a`_agimkklebeijkecgd][\\]]\]\[]ZWROOPONNOPQSTV[^ejjjiejnooonihdgcacknmfdjmnnjhjnooolecbimkjhbcb`bdiecbimnoollnkca_bjnmibccafhmkkmiggdbafhnoniaba[YWXXX^`_bijknnihehdba``gheilihc^][Z[\]`dbdhf~~~~~~~~~~~~~~~~~~~~PPPPRRRVVWZXVV[`bebcb`cinnooonkd\YY]^]]bdd_``_aghjknmhaabadf`abaelkjjehebekged``^^]`hke[ROMMLJJJJKQSU\^\____]__]_`_gmoookkiceijnonjfd`YRRSS[`_`aahmlecaeknnkknnjcZWWZbddddb`ckmhfacelooonmihc`bdbfdbddcgf__^^```abbfb`ab]]^]afinnkkihgd`_^\^^]_bjlieiljehijb__bghechieiide`\]\\]\\\]\^__ba_a`^`ckonjieciieiibba`fdbfgcejllfchhbdgdjmkjhbcehig`aaada`bgijklecbikdba`fdbghmkknkknnmgeddaXUUWYafjkkkmkdadkkkoonjb_Z[[[`abilihjnolklebdgdijjjcabb`be`abbgimllnkkkknjid`bb`cecedcijeaa_bjnooni`]^^\]^^_`cjkkkkkebaeedjmnmhaabcimllooooolfcgfbcb][[Z[ZVTSNMNNOQRVWX[]_febffdglnlebejjihdggdefhnoonkdfebehcflooooomljebelnlecgd\\\\dhijecgebfcacjiiecgecgecikdba`ecaeedjnnjhjnonjhjnooooolfbe_]]\WWY[ac^\YUPPMMMNPRT\`cgc^YXWWXWWXWX]^dedinonihijdffdhinonja_]^^Z[[[abaggbcelkkkkicedbeebeijlf``cjia^_``eknlebeloooooooonjdflnoooonlfdjnoooolecgdcgdadfabeijnonkfkmkjidgcacf`abcinooonihijcacdbec[[[YXVW]_daaahlnole\YXXXX`hkebaeknjheifdb`^^^YXXVTTUWXWXUUVYZ_`bdkjjhaab^VTTTVW]bbeimleceedhg`abaekigb_acjjjhffdijknnkca_acaddbejibbafhjjibba`dlonjdflnkdadkoonhgghmkeiecijg`_]Z[cjkdba[SRSSY[ab`cb^^__egmmi`]]YY[[aghig`]\]`giif_[URRSTUXXXYXYYY_`^]__dknnklnkkjic_^[\]^ehmnkeabejf]ZSSRS\b`]\XVOMMLMMMMOUVZ[\Z[]\^^^gloolidfbbaahica_]_`__^^`ikknnnnnlkkd\ROI@>;61*((&&%%$$##%&&&%##$$)*,../58>@GMOTUUX^afhnonhf`^\[[XXXYYbjjjihimjf`WNE<9211/-,++'%%$$$$###~~~~~""""""""""""""""#######~####$+-6=@AINOPVZ]cgmkd[XVVUSSUUPNLLHH~G~BA;860-)'(****(&')**+,,-/2~9<ENUW]^^\\\]bbfhgdgcZWUUXXafhljegd\\dfea]]]YY]]bimnkjia^^XPNLKKKMSTV]cciicehdhdacebekkkmiaa_achijiha[[^\VTTUYbhe^^ZWVSLKIHHGGCCCCCCEGNPWYYYXYZYZ\^gmkkmia]WUSRRTWVRNNNXaiieikjc`bb`bbagedc^]^ekmollooookkicba`fdbfb`a[YYXWW`fhmnmfciihilgfebdgghhcegbdb`cffhkfcihgejnonjc``hmkkniaXWVVTTUYZZ\\\^baccdbebddbeebekkkkklfdjnoonigcfkjehebedbdcaimnie`_bbZWWY^]\\^_^]]aikfdjmonkd[YWWWWW]^\[]\]cee^^\[[\]aa_]][[]]_a^^]YXXX^\ZZ[`hicadknkeab_`_XVVUUURRUUVWWY]]^`bjkkmibde``c`^]Z[bfdhhdgimkejib_aaelnlfdjnolfdjlfdcc``[[agca[[_a````^^bjmjc_^`_cdfgfceloonihhgf`^\WOMLJJJJJIIHHHILLU^edc]]]\^^]^^flnnigceijnooooonjhjnomjehinnibceijnonibcellha`_]_a_[WRQQQPPOLKKKKKKKKJIGCCA>===;951,
   6.712 +p                               ~~~~~~~~~}|}~~~~~~~~~~~~~~}||}~}~~|zvrmmlljjifcba^^___________~~~_____^^^\ZWRNIHFCCCCCCCCCCCCCBBBBBBBBBBBAAAA@????><99~~~744444444444221/+'#""""!!!!!!!!!!!!!!!!!!$&'*-..016:>ABCFGHKMNRW\aeikmnprruww{|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}yxxyyxxyyz{z{|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zxuutuuz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}}}~~}}|zwvuttuvwwxxxwurnmmmmmmmmnopsuv{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~||zwvvuttttttttttvw|~~~~~~~~~~|xwwwyz}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|wvvuuuuuwwyyz{{{{}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|}}|zyxvrqqqpppppqrtuuuuwx{}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~}xtojea\WRNID?>=95100/////////////011256777899;<AEIMNOTY^bglqvz~~~~~~~~~~~~~~~~|xsnie`[VRQONNNMLLLLLLLKKKKKK~~~~~KKKKJIIIIIIIIIIIJKLLMNN~NNNNOPQTVWXYZZ[^`aaaaaaaa``_]]]]\ZVVTS~R~PPNLHDCA>>>>>>>>>????ABGLP~UZ^cgjlmmnnnopquxyz}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|yyyxxy}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vqpponmmmnnmmllkjihfeeeeeeeeeeeefghikllnortty~~~~~~~~~~~~|||~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|||{|~~~~~}}~~~~~~}}|{||}}|}|{z{{{{zz{~~~~~~~~~~~~~~~}|}|}}||}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}xxwwwvuutssrssuvz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zxuqmhgeba`]YUPOONNNLJIIIIIIIIHGEA@?<;;:973/*
   6.713 +
   6.714 +a
   6.715 +s chickenMito 9461 2072 + 16775 TCACTTATCCTAATACTCCTCTCCATTAACCTCCTAGGCCTCCTCCCCTACACCTTCACCCCAACTACCCAACTATCAATAAACATGGCCTTAGCCCTGCCACTATGACTAGCCACCTTACTAACAGGCCTGCGAAACCAACCCTCCGCCTCCTTAGGACACCTACTCCCTGAAGGCACCCCCACCCCACTGATTCCAGCCCTAATCATAATCGAAACAACCAGCCTACTTATTCGGCCATTAGCCCTAGGAGTACGCCTAACAGCAAACCTCACAGCTGGTCACCTACTTATCCAACTTATCTCTACAGCCACAATCGCCCTACTACCAATAATGCCATCAATCTCCGCCCTAACGGCACTCATCCTATTCCTACTAACCATCCTAGAAGTGGCAGTAGCAATAATCCAAGCCTACGTCTTCGTCCTCCTCCTAAGCCTCTACTTACAAGAAAATATTTAATGGCACACCAAGCACACTCCTACCACATAGTTGACCCAAGCCCATGACCAATCTTCGGCGCAGCCGCAGCACTACTAACCACCTCTGGCCTAATCATATGGTTCCACTACAGCTCGACCACCCTACTGACAATAGGCCTCCTCTCTATACTTCTAGTCATGCTGCAATGATGACGAGACGTAGTCCGAGAAAGCACCTTCCAGGGCCACCACACCCCAACTGTCCAAAAGGGCCTACGATACGGAATAATCCTTTTCATTACATCAGAGGCCTTCTTCTTCCTAGGATTCTTCTGAGCCTTCTTCCACTCAAGCCTAGCCCCAACACCAGAACTGGGGGGCCAATGGCCCCCAACAGGAGTCAAACCCCTAAACCCCCTTGAAGTACCCCTACTAAATACAGCAATCCTCCTAGCCTCAGGAGTCACCGTTACATGGGCTCACCACAGCATCACAGAAGGAAACCGAAAACAAGCCATCCACGCACTAACTCTCACAATCCTCCTAGGATTCTATTTCACAGCCCTACAAGCAATAGAGTACCATGAAGCCTCCTTCTCAATCGCTGACAGCGTCTACGGCTCCACCTTCTTCGTCGCTACAGGGTTCCACGGACTACATGTAATCATTGGATCATCCTTTTTAACAGTTTGCCTCCTACGACTAATCAAATTCCACTTCACACCAAACCACCACTTCGGATTTGAAGCAGCAGCCTGATACTGACACTTCGTAGACATCATCTGACTCTTCCTCTACATATCCATATACTGATGAGGATCTT--GCTCTTCTAGTATACT--CATTACAACTGACTTCCAATCTTTAAAATCTGGTATCAACCCAGAGAAGAG-CAATGAACACAC---TTACATTTATACTCTCACTATCCTTTCTACTAAGCGCTGCACTAACTACTATAAACTTTTGACTAGCCCAAATAGCCCCAGACACAGAAAAACTGTCACCGTACGAATGCGGATTTGACCCACTAGGATCAGCCCGACTCCCATTCTCAATCCGATTCTTCCTAGTAGCCATCCTATTCCTTTTATTCGACCTAGAAATCGCCCTGCTTCTTCCCCTTCCATGAGCCATCCAACTTGCACACCCTATAATAACCCTTACTTGAGCCACCACTATCATCGCCCTCCTCACATTTGGTCTCATCTACGAATGAACTCAGGGCGGCTTAGAATGAGCAG---AATAACAGAAAGTTAGTCTAACTAAGACAGCTGGTTTCGACCCAGCAAATTATAGACCCAC---CTAT-----AACTTTCTT-ATGTCTCCCCTACACTTCAGCTTCTATTCTGCATTCACATTCAGCAGCCTAGGACTAGCATTCCACCGAACACACCTCATCTCTGCCCTACTATGCCTAGAGAGCATAATACTATCCATATTCATCCCCCTCTCAATCTGACCAGTAGAAAACCAAACCCCATCATTCGCCCTTGTACCTATCCTAATACTAGCCTTCTCAGCATGCGAAGCTGGCACAGGCCTAGCCATACTAGTAGCTTCTGCACGAACACATGGCTCTGACCACCTACACAACCTAAACCTTCTACAATGCTAAAGATCATCCTACCAACAATCATACTCTTGCCCACAGCCCTC
   6.716 +s humanMito   8746 2062 + 16571 TCCTTAATCATTTTTATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAACCACCCAACTATCTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCGCAGTGATTATAGGCTTTCGCTCTAAGATTAAAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTATCCCCATACTAGTTATTATCGAAACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTACGCCTAACCGCTAACATTACTGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCAACCATTAACCTTCCCTCTACACTTATCATCTTCACAATTCTAATTCTACTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAGTAAGCCTCTACCTGCACGACAACACATAATGACCCACCAATCACATGCCTATCATATAGTAAAACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGCCTAGCCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTAACCAACACACTAACCATATACCAATGGTGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACCACCTGTCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCTACCCCCCAACTAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTAGAAGTCCCACTCCTAAACACATCCGTATTACTCGCATCAGGAGTATCAATCACCTGAGCTCACCATAGTCTAATAGAAAACAACCGAAACCAAATAATTCAAGCACTGCTTATTACAATTTTACTGGGTCTCTATTTTACCCTCCTACAAGCCTCAGAGTACTTCGAGTCTCCCTTCACCATTTCCGACGGCATCTACGGCTCAACATTTTTTGTAGCCACAGGCTTCCACGGACTTCACGTCATTATTGGCTCAACTTTCCTCACTATCTGCTTCATCCGCCAACTAATATTTCACTTTACATCCAAACATCACTTTGGCTTCGAAGCCGCCGCCTGATACTGGCATTTTGTAGATGTGGTTTGACTATTTCTGTATGTCTCCATCTATTGATGAGGGTCTT--ACTCTTTTAGTATAAA--TAGTACCGTTAACTTCCAATTAACTAGTTTTGACAAC-ATTCAAAAAAGAG-TAATAAAC---T---TCGCCTTAATTTTAATAATCAACACCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTCAACGGCTACATAGAAAAATCCACCCCTTACGAGTGCGGCTTCGACCCTATATCCCCCGCCCGCGTCCCTTTCTCCATAAAATTCTTCTTAGTAGCTATTACCTTCTTATTATTTGATCTAGAAATTGCCCTCCTTTTACCCCTACCATGAGCCCTACAAACAACTAACCTGCCACTAATAGTTATGTCATCCCTCTTATTAATCATCATCCTAGCCCTAAGTCTGGCCTATGAGTGACTACAAAAAGGATTAGACTGAGCCG---AAT---TGGTATATAGTTTAAACAAAACGAATGATTTCGACTCATTAAATTAT---GATAA---TCAT-----ATTTACCAA-ATGCCCCTCATTTACATAAATATTATACTAGCATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATATCCTCCCTACTATGCCTAGAAGGAATAATACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCAACACCCACTCCCTCTTAGCCAATATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTGCGAAGCAGCGGTGGGCCTAGCCCTACTAGTCTCAATCTCCAACACATATGGCCTAGACTACGTACATAACCTAAACCTACTCCAATGCTAAAACTAATCGTCCCAACAATTATATTACTACCACTGACATGA
   6.717 +s mouseMito   8145 2069 + 16299 TCCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGGCTTACAGCTAACATTACTGCAGGACACTTATTAATACACCTAATCGGAGGAGCTACTCTAGTATTAATAAATATTAGCCCACCAACAGCTACCATTACATTTATTATTTTACTTCTACTCACAATTCTAGAATTTGCAGTAGCATTAATTCAAGCCTACGTATTCACCCTCCTAGTAAGCCTATATCTACATGATAATACATAATGACCCACCAAACTCATGCATATCACATAGTTAATCCAAGTCCATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGATGACGAGACGTAATTCGTGAAGGAACCTACCAAGGCCACCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCGTTCTATCATTCTAGCCTCGTACCAACACATGATCTAGGAGGCTGCTGACCTCCAACAGGAATTTCACCACTTAACCCTCTAGAAGTCCCACTACTTAATACTTCAGTACTTCTAGCATCAGGTGTTTCAATTACATGAGCTCATCATAGCCTTATAGAAGGTAAACGAAACCACATAAATCAAGCCCTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGGTTCTACATTCTTCATGGCTACTGGATTCCATGGACTCCATGTAATTATTGGATCAACATTCCTTATTGTTTGCCTACTACGACAACTAAAATTTCACTTCACATCAAAACATCACTTCGGATTTGAAGCCGCAGCATGATACTGACATTTTGTAGACGTAGTCTGACTTTTCCTATACGTCTCCATTTATTGATGAGGATCTT--ACTCCCTTAGTATAAT--TAATATAACTGACTTCCAATTAGTAGATTCTGAATAA-ACCCAGAAGAGAG-TAATTAAC---C---TGTACACTGTTATCTTCATTAATATTTTATTATCCCTAACGCTAATTCTAGTTGCATTCTGACTCCCCCAAATAAATCTGTACTCAGAAAAAGCAAATCCATATGAATGCGGATTCGACCCTACAAGCTCTGCACGTCTACCATTCTCAATAAAATTTTTCTTGGTAGCAATTACATTTCTATTATTTGACCTAGAAATTGCTCTTCTACTTCCACTACCATGAGCAATTCAAACAATTAAAACCTCTACTATAATAATTATAGCCTTTATTCTAGTCACAATTCTATCTCTAGGCCTAGCATATGAATGAACACAAAAAGGATTAGAATGAACAGAGTAAA---TGGTAATTAGTTTAAAAAAAATTAATGATTTCGACTCATTAGATTAT---GATGATGTTCAT-----AATTACCAATATGCCATCTACCTTCTTCAACCTCACCATAGCCTTCTCACTATCACTTCTAGGGACACTTATATTTCGCTCTCACCTAATATCCACATTACTATGCCTGGAAGGCATAGTATTATCCTTATTTATTATAACTTCAGTAACTTCCCTAAACTCCAACTCCATAAGCTCCATACCAATCCCCATCACCATCTTAGTTTTCGCAGCCTGCGAAGCAGCTGTAGGACTAGCCCTACTAGTAAAAGTTTCAAACACGTACGGAACAGATTACGTCCAAAATCTCAACCTACTACAATGCTAAAAATTATTCTTCCCTCACTAATGCTACTACCACTAACCTGA
   6.718 +s fuguMito    8292 2075 + 16447 TCATTAATAGTGTTCCTAATTACCATCAATATGCTAGGACTCCTTCCATACACATTCACCCCCACCACACAGCTTTCCGTAAATATAGCCCTAGCTGTACCCCTATGACTCGCAACAGTAATCATCGGAATACGAAACAACCCAACAGCAGCCCTAGGCCACCTTCTTCCAGAAGGCACCCCCAACGCTCTAATCCCTATCCTAATTATTATCGAAACTGTCAGCCTCTTCATTCGACCTTTAGCACTAGGAGTTCGACTAACCGCTAACCTCACAGCAGGCCACCTGTTGATTCAACTAATCGCTACAGCTGCTTTCGTACTCCTCCCCCTTATACCAACTGTCGCCATTCTGACATCAACCCTATTATTCCTCCTGACACTTCTAGAAGTCGCCGTCGAAATAATCCAAGCCTATGTTTTCGTACTTCTTCTAAGCCTCTATCTACAAGAAAACGTTTAATGGCCCATCAAGCACACCCATACCACATAGTAGACCCAAGCCCATGACCCCTAACAGGAGCAGTCGCTGCCCTTCTCCTTACATCCGGCCTAGCCATTTGATTCCACTTTAACTCAACTATCCTAATAACCCTAGGACTAGTCCTACTTTTACTCACAATACTTCAATGATGACGAGATATCGTACGAGAAGGCACATTCCAAGGCCACCACACCCCTCCTGTCCAAAAAGGCCTTCGATACGGAATAATTCTATTTATTACCTCCGAAGTATTCTTCTTCCTTGGCTTCTTCTGAGCATTCTACCACGCAAGCCTAGCCCCCACTCCTGAATTAGGAGGCTGCTGACCCCCTACAGGCATTATCCCCTTAAATCCCTTCGAAGTTCCCCTCCTAAACACAGCAGTCCTACTGGCATCAGGAGTTACCGTAACCTGAGCTCACCACAGCATTATAGAAGGTGAGCGAAAACAAGCAATCCAATCCCTCACCCTGACAATCCTTCTAGGTTTCTACTTTACATTCCTGCAAGCAATAGAGTACTATGAAGCCCCCTTCACAATCGCAGATGGTGTTTACGGCTCAACCTTCTTCGTCGCTACCGGCTTCCACGGCCTTCACGTCATCATCGGATCAACCTTCTTAGCCGTATGTCTGCTACGACAAATCCGATTCCACTTCACCTCCGAACACCACTTTGGCTTCGAAGCAGCCGCCTGATACTGACACTTTGTAGATGTTGTCTGATTATTCTTATACATCTCAATCTACTGATGAGGCTCATAAATCTTTCTAGTATAAAGTCAGTACCTGTGACTTCCAATCACCCAGTCTTGGTTAA-ACTCCAAGGAAAGATAATGAAC---TTACTAACAACAATATTAATTATTACCACAGCTTTATCCCTCATCTTAATGACCGTCTCATTTTGACTCCCCGCCCTTACACCAGACTACCAAAAATTATCACCATATGAATGTGGCTTCGACCCCCTAGGGTCAGCCCGACTCCCCTTCTCACTACGCTTCTTCTTAGTCGCAATTCTGTTCCTCCTTTTCGACTTAGAAAtcgcccttctcctccccctcccttgaGGAGATCAGCTCCCATCCCCCACCCTAACACTTATATGGACCTCCGCCCTTCTAATTCTCCTCACAATTGGCCTAGCCTACGAATGACTCCAAGGAGGCCTTGAATGAGCCG---AAT---AGGTAATTAGTTTAATCAAAACATTTGATTTCGGCTCAAAAAACTAT---GGTTA---AAGTCCATAATTAACCTG-ATGACCCTCATCCAACTCTCATTCACCTCAATCTTCTTCCTAGGACTATTCGGCCTTGCATTTTACCGAGTCCACCTTCTATCTGCACTCTTATGTCTTGAAAGCATAATATTAGCCCTATTCCTCGCACTTTCAACATGAAGCCTGCAAATATCCTCCACCAGTTTTTCAGCCGCGCCGTTACTCCTTCTAGCATTCTCAGCATGCGAAGCCGGTGTAGGACTAGCTTTAATAGTCGCCACAGCCCGTACCCACGGATCAGATCACCTACAAAACCTAAACCTCCTACAATGCTAAAAATCCTAATCCCAACCACTATACTTATCCTAGCAACATGA
   6.719 +p                               cb`_aginnjd`abdjhf`ZYY`dee`abaejjjjdeeab`]]_`ccaca\\ciihjnnmigceecihhikkooolfcikfed`a`ZWWYaebdffbZWWVUUXbjnomhaabbfdchiceiiieige`VTRRPJHHHHHGHHHHHHHHIKMNU[\dggimleb\YYZ`cjmkjhgbcdaa`\[YXYZZ]_^`_]]]]aike\ZZ`ciijkfcigffc`cdcjnkkmhaaahjknkkkkjig_`^\\^^cdbhhbc`^__^`ccimolloollooooonigcehc`bd`a`bgejmkknjidbdd`^__ccbfdaejie^][[WUUVVVX^__]XVOMMLKIHHHHHGGGHHHHIILRUUXXY[^^]abafhmoonkeihcdcackmjb_]^_fiejjehecghhhcachinlloooleacekjd`aa_bjnoollnkjhdggcehdggdjidffdilmnkloonjhimjidb`bbeinmfdjmnlieikli`]\\[]\\^dacelonja_]]`fghba`^a_]\\]`hnnjhilhfb^^a_abafdbeebekmh``bfdhlnjhjnlf]XWXZZ[\\^a`bfcec][\[[[[^bbfhjkoomjcehigea`[[`dacb`cikkhceijlecgecggdhhejlhe`afhde`^\]^`cbimkkkkkkkknkjjihe`_]YXZ`ghbdedddfgfbdecjnnmicbaahkihcacjkdb`c_[Z[`debeijjc^__`achecbimnkkkdb`bdlnonkc`a`_cfbegaccaimkjhab]\]^\]\ZYXYZ]]ekmihcZWUUW^ca_`_^achjnnhf``ZWWWWXY[]_]]]Z[[[agmnllonjhjnlg_`^]]_`fgbccbije\\\cfdjnooonigdgdbeljiecfdcjnoooomjdflonjcdcacijh`^[Z[\\\_ghghiheadhca_bjkklebehegcachijc`bcb`djmhaabbfdade____edbahiiiceijjdadkmkfcjmkdb`b^\[[WWXZacgdgimiggeciieffejmomjdfebdfcfkia^[[[Z[]]abagidffdhijjjehjnkcacgeiiceijnkkihekmkjhbcdggdbd`a`a_cc[XXVV\\_dbdhjnleb`dgginolecbilmia^_`cknooolebaddbba`hjknkkkecgecjnoooomfdjlhgghnoonkeihcedbelniaYYYY\aaefdjmnnkklebelkkoooolecbimkl~~nkg`]]^ainnjgb_]~~^^\[ZWVVVZZ_efgb`YWPMFDBBBBEEFNTTSRTT~UVWYZY[[[`ehj~ia_XUUUS~~~P~~~PNMMMLLLLMNNNNOPQRSTVXYZYXXZZZ]_YWUTTTSSU\bba^YXWVV[]_gjecaelnlg_^^]``_]^YXWRQQRY`a[\chdbaaa^]ZZYY[\\_echecjmnihehinonjhije^\ZYZZ[\a_\[ZXWYY\]]_aijdacjgeeeca_bdjhgcflonjceiih`YWVTTW`fhlihimjdflonihikkjc^^]\\\XWWW\\]aimklooonjb^^__da_^YPMFD=:87776666679>??AABBBBBDDEEEEEEEEFHNPVZZXXZ]^bghcb`dga^__afceecimnleche]ZZaeeddefjigd^URKB?8/,,+)"$$#%&~~~/8?AGHJQU\^deb_^\]]^^^_egmonjhjnomg^[TQJA8532-+~~~)(''&#&&%-12~~~~~323321/*(%(*******+024;=ABDFIJKLNNPPPPY`e_ZXUSRRRRVWZ]dfjknnjb_^_`dc\YY]^^]`hlkjhehjjjicflnlgd_^]]ainooookkjceiihgcejecggcejh_XXY[___gijmke`a_[[YYYXXVVW\`beabcea`_^`db[XRPNMLLLMNKIIIJKMQRTUW]]\^cehbZZ]ehb[[[[bbahjkoooollooomibcd_`a`cknnjhjnooomg^XVUVVYY[[[\_gjieihba`ZXYahhcfmonjbdb_`a`cfabeijnomjceijnkcZPMLKJIHHHGGGGGHHKSYZ\\^a_^cimnnkknnjceecilj
   6.720 +p                               ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zxutttuuuvwwyzzzyyyz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{{yyy{{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|{zxwwwvvvuusponkjjjhhhgggggghhiiiiikkkllmqtuvy{|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}||}~~~~~~~~~~~~|{|{|||~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}~~}}|{zyyy{|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{|{{}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~||zxwwwyz~~~~~~~~~}ytssssuvvwwwvvww~wwx{|}~~~~~~~~~~{vrqol~~~h~~~geeeeddddeeeeeeeeffffffffffgggijjlllmmmmnqtuuuuuvvvy{|~~~~~~~~~~~~~~~~~~}|{zxwwx{|}}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zvqlkjfbbaaaaaaabbccccccccccdddddddeeefijkmnoopstux{||}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vrmhgeb^]\[ZZZ]_`~~~dhklmmnsx}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|yup~~~kgb]\ZZZ\]^^~~~~~^^^^^^^]\ZZZZZZZZZZZZZZZZZ[[[[[[[[[[\\_abbcccccdddfglquz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|yxwvvvvvvw{}~~~~~}{zyvutqmiddbaaaaaaaaaaaaaccefghiijnprsstx|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{{||~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
   6.721 +p                               SRNNOOQTTPNMLKJJKKKKQRVWYZafhjknkkjdfebekhgbYXWUU]`^_^``_cb_acghecihhikkooomjcfjhggdbdaded`a^_^]\\XXWVVYbhe\TSSSSTTTSRRQQRRTV]ZXQNMLKF>;:99999999::::;;ABELPPPQRSRQQPPRTXYZ[bdiifd`]]][\[YYYY]`_a\VTSQQRTW_a`a`db`cjnmged`^__binlloolfcijjhaadecacjmhffbZZY[dkooollnjiechhabddabahieiidfecelkkoolfcihbb]Z[YXYWSSSSTTUXXXWTPOOLJE<:94+++*****))&$$$$$$#####$$$$$%%%%%%%%&&&'*./1233336?IQVW[`ahlklonlebaebdheiiegc`a~~~~~~~~~~~~~~~~aab`ZXX[\\^`_`fiknlknonjb_``cb`b`]^^^_]]`fikeaa`ciijiheijid\\bekicegdhjkg_XVUTTTUW`eegmnkd[XUTTRRRSUUUVVTTUXZ_gkebdgcekhfaagijkecghjjib__bhhdgd``_^`fd\ZXWW`ec`a^]_`_cfbdfbb```gkkkigbZYWPNLKJHHHHKSYZZ[`_\WUTVY`ciecgecggdgheig`ZYY_gmmihjnmjc`a`dda_`chimkjjigc`abb`cknnhga^]\[]_dedcjnoookca_bjkkmigb[\\\dhjkfcjmlh`]][Z[[[^`ggfa\\dhjkdb`bdlnoonigb_[[[bdlnkdadkkkoolfcbb^_][[[Z\adhbYYXVVVWY_`giigedegjknleb\\cbZWVVWW]eedc__`acdbijkke\\\[aebejhffdhgd^][Z[ZZ\]_a`fdcimnkkke]VVVVX[[bcbgebeloonkjidgc[Z]]``dd^[XWWZ^dfib_^]__][[\_`^`a`hmmg`XUUWY^_fjhgb^]__cc\[[YY_ehjca`^_\XWW[^flnkji`[YYaikibXOLJJJIHHHHHJLSV\\\[\\[[]]ekiceheknooollmia^_`^^]\]]^ehehecilkecafhjknollnlfcggdihbccbhijiheihaYWUUUUVZZ\]YY\]`e`]]]\][\[VVUUTVUUU\^^^aijdbadaYPPOPPPRXY\eidbaddaba`hjklecgecijkoooooomfchg````hlljd__`^^`_dknlha`_]_a`b`^^``cejkgdffbflooolecbimih~~ejmkecaelnlic[XV~~VZZ]_]YXXZZ[[WUOLEA9211100000//////-,!!"#$&&((/1566~6655320,"$$"~~~$$$%%%%%%%%%%%%%%%%%%%&&&&')+2566788888:CJMNONNOPQRRQQQQXZ\^gmnkcZZY[[YVTNNNNMMNPVZ[[]`\ZYXWRRRSUUWXZ`hmlfcjmmigbbaahjca^ZZ]\YXXXZ[bdeec\\cddcabdkjc`bc^]]aghlihcackoookd]]WRQQRVZYXXX]`fdbbhicfloniggecihghgab`^ZZZ^^_abafhnoonh_\ZZVUSRQPQRSQQRQPOOPQRRUUUTTUXYYVUVUUSQOKKKIHHHJKNUXXXYZ_``^XXXXWYYZ^fhd]\\`egdgb`a\SPPPVXWWXY]`afgfd]TQJA>=74~~~.+)#&&#()+--.7>AABJMNNNPPQVWTTV^a`degllg^VSQNLKIC@=8/"#$"#%()~~~*+-.~~~~~../012458~?BCCCCCCCCCBBBA;:5421110000001:CJLLMNMMMMNKJJJKNR\dghechd\\`^`__dbdgbbjnoollnnkgba\YY^`bknooooollmhc[UUXY\eijnooonia[[_\\[ZVMGEDCCBBCDDDFFFGIIJJKLLLNNOOPQQPQQQQPPPPQPPQQQQSX]cdcghgaXSRRTXaglnmh``^\YY]]ccbinonjhd^URPPPQSUX_ajnlecaeeea[RI?>=9777777789;>??ADLQROOQY^aafecjlliegikknihiiiebggbeijnonia^]YZ^^`ca`a_`bdddc^[XWQI@?<;:5321000000111
   6.722 +p                               iiiiiiiiiiihhhhhhhhhijkkmnsx|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}yupkjihgea`_^][WWUUSQQQPOMIEDDDCCCCCCCCCCCCCCCCBBBAAA@@@@@@???????@@@@CDEGGHHHJKKKKKLMMOOPQUZ_cgikknoprstvvwxxxxxxxwvvvwz|}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|yuusrqonmkjifeda]YTPKFEC@@>;;9664211111111000/.....--,,,,+++++++*****************************+./036779:?CGJLLOQRW\`ejnqsttvvyzz}~~~~~~~~~~~~~~~~~~~~~~~~~~~}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{wrqqppppqqqrrrrrtuy}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|wsrpmllkkkkkkklmmmmnnnnnnotx|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{zyyyy{{~~~~~~~~~~~~~~}||{|}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{{|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~yxxyyxxyyz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}~}~~}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|}||~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|yu~~pomjfb]\ZWSOJEA@~~?????>=<<<<<<<;962-)$##############################~############~~~#######################################$(+-.///114566778<AEILMMNNNNNNNNNNNNNNNNNOSVXY]`bccccccddffiklquy|~~~~~~~~~~~~~~~}yxxwuuuvwx}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}yyyz}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|wsnihffeb_^^^^^^^^^]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]^^^^^^_______________________________^]]]]]]]\\]]\\\\\[ZZYVSOJJ~~~HEA<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<;;:9888752.)$$$$$$$$~~~$$$$~~~~~$$$$$$$$$~$$$$$$$$$$$$$$$$$$$$$$$$$$$$%%&'''''''''''''''()-13555666666677788:;;<AEJOTX\`bcceffglpuz~~~~~~~~~~~~~~~~~~~~~yupkgb]\\[[ZYVSNNMMMMMMMMMMMMMMMMMMMMNNNNNNNNNNNNNNNNOOOOOOOOPTX[\]_abbbbbbchmquy{}}~~~~~~~~~~~~~~~~~{vvtsssty~~~~~~~~~~}zuqlhcbbaaaaaaaaabfikkorsttttux{}}~~~~~~~~~~~~~~~~~~~~~~~~~~~yupkfb]\\[[ZYVVTTSQNIE@;7641-,***)))((''''''''
   6.723 +p                               $$$%%%%%%%%%%%%%%%%%%&&&&''((()*+.016:?DHKMNNPPPQTVW[_``^a_\]\\_egidaddbgdacb^_ddcc_`eikebadaba]\]YYXXX[dhbYONNNNOQZ`ghbccbhhccb^]^^`^VTSSTSRPPOOOPPPRZ_acc\SPPONHFFFFFFMPWY_bffb]VRQPONLLLNORVW[aa``_efcejecgimkkooonhffc_`gmonifbZZ]elkkicefd`_bjke`a`YYY[abahhcflkkkkoonjieabbhieknokkkknkif_^`agdbfcacjge_\[YXXVVXWVUUSSSPNHE><52222222222000000000000111679<===========>>>?ABFGJKLT\bb`ZZ\]ahmlecbimlfcjlkf^]^afhmkkkknllmkeigffgf`afijjic_`fiknlknnmicegbcb`b`]^^^\[\_ehkebeeghceggdhigbZXXY^`_cfdhjlkcZWUTTUUW`eegmoonhgghmkknldb`ba__cdbcbhgfda_`b_^``eecijkkkkkooolklebekkca_bjjc`]]_\YSJIHHHHHHHHHHHHHIQVVWVUUTQIG@?????@ADKPRSXYY[[YVVV[bejecgebedbcc_\\ZZZ`flmkca_bjnnlecghjkkkkknkjjihc_abc~~~~~~~~~~~~~~~~~~~~~~~~~~dflihcackmihjnklnkklfcijjjb]]]]_bhfd_YXZ^__`_^adknonkc`a`_dkkkmhba_bjkkooldb``_c_\\[[\abadjihcZWUUW^dcabaaabadknllnia^^XXXWVWZ`acfa_]\^_ghhe\YYZZaijknjhimnmiccage`_cjmjcflooookkibXUUVVX^_chjnoooooonkjiegc[Z]]`fhf_\ZYYY[\_ca_^]_`_]^bca`bdc_^[[YSQRRTWX`ggf`ZXYYac`abb`ejkhaabdga^^afhjejjjh`[YYaikmomh_XXYWUUWW\]`fglh`]^][\^^egcdc_^`_cknlloonjhc`_^\]]^fhehecgecgimkkkknnigceijnooooolecgdbefdjlhga^^^ZXXUUWUUVVVVPPQQQUVY]\^^][][[\`a`_bikecafdbhgfacejicflmihikknlloolklfcijknkloooooomfchgaabeloooomjc`bcaekh``_XUSSUW]_]^cggcadknmjdflke[SIF?<5,+!"!""#$$%)0222210,#)$-5:DLQQRUW[dhiihda[SQJGFD@7.--*)('''~'&&%%%%$$$####,1234443~~~/"#%"#%))*+-/56899999::;;<<<===>@BIMNOOOOOOPPPQRRRRRRRRTTTXaeefhlg_VLKKHHHHHHFEDCCCDDFFFFFHKLMMNONNNPQUWY^cbgebffcfinllonh`][Z[]]YXXYZ\cdedb[[`^]\\]`fd[XX]][[]cfkkknkkonkeig`a_]WWX[\YWWVUUUXXY_^XX\ekhggechgeda^__\\]\^_`ac]]\WWTQJA?====<<<<;;;;;<<<<<<==>>>>>>>>>>>>>>=============>>>>>>>>>>>>???????@@@@AJT\cgdhecjmomhaa_^\\^_^ZXYY`a`hmoolln~~~jie~~~cffd\WW\dkhggdbagedcc`XWX[dkihikfcgf^URPOMGDDA:~~~60/-,~~~'%$$'&%$$'))*,1246~=FMPVXZ]YQHCA@???==<<<<<<<;;;<<<<<<<==>>ABCENSUTTVV[\YWWUUUZZ\\ae``[SPPQY^``\YYadaYVVXX[\XX\dihabb`c`^\]^`hjjlicefaa_bc]\[XQNKJIHEEECCA@????AAAA@=5332222222222211111111111246:;<======>>@AHJT]d`WWWWVWZZabainonkjf^VVUUVWW]__bjmia^^`cbimmib\ZWVTSTTTSSTUUUUWY\\XVV_dbZZabbimkeabeijmihijihcegceijnmjf`\XTONMLLLLLLKKIEA=<::863..,++++*******))('
   6.724 +p                               """##################$$$$%%&&&'(),./48=BFIKLLNNNORTUY]`abefgjlmqvz|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|ytpooonnnoooonnnmlkiiheeedddcbbbbbbbbbbbcccdimrvz}~~~~~~~~~~~~~~~~~~~~~~~~~~|{zzz{|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|wsnid`[ZZYYXWWVTSROLHCB@@@?????>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>???????@@ACDDFFIKLPTVWWWXZ[_dimprrw{}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zyyxvtpommmlllllllllllllllkiiheba`_______`dfghjkkmmnnnosx{~~~~~~~~~~~~~~}}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|}||~~~~~~~~~~~~~~~~~~~~~~~~~~~~}yxxxz{~~~~~~~~~~~~~~~~~|xwvutrqqqrttx|~~~}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}zvusssrrssssrrssstuwxxyzzyyyyy}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{zvrnie`[ZXUTSSSSSSUUUVVVVVVVVVVVW[^`abbbbbbcccccccb`]\ZZYYXVSRQNJIIII~IIIHHHGFFFEEEDDDDDDDDD~~~DDDDDDDDDEEILNORTUVVVVVVVVVVVVVVVWWWXXXXXXXXXYZZZZZZZ[[[[\^```aaa```^^][[[[[ZZZZZZZZZZZZ[[\`cefffffghikmmprruwwz|}~~~~~~~~~~}yxxwuuuvwx}~~~~~~~~~~~~~~~~~~~~}|}~~~~~~~~~~~~~~~~~~}|}~~~}}||~~~~~~~~~~~~~~~~~~~~~|wvuqqqpponlhdca^^\YVQPPPPPPPPPPPPPPPPPPPPPQQQQQQQQQQQQQQQQQQQQQQQQQQQQRRRSSSSTUUUUUUUUUVVXX[]^cgknopsuvz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{wrmihhgggeb_ZVQPNKGBBAA?<<:7~~~4/.-,~~~++****************~**********************************************************+++++,,,,,,,,-.///////0000000000000000000000000000000///////...-,))'''''&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&''''''''''())++.001112223458:;@DIMQSTUUUVVY[[^`aehjkkklmnnooooonmmlllllllllllllmmmmmnnqrsssvxy~~~~~~~~~~~~~~~~~~~{{yvrnie`[VRMLJJIIIIIHGEB>:97653/+*(((''''&&&&&&&%#
   6.725 +
   6.726 +a
   6.727 +s chickenMito 11649 1419 + 16775 AACAGGCATAGACCAAATCTCAACTCCCCTCTTAGTACTCTCCTGCTGGTTTCTCCCCCTCATAATTATAGCTAGCCAAGGCCACCTACAACATGAACCCCACAAACGAAAACGAATATTCATCTCCACCTTAATCATCATCCAACCATTCATCATCCTAGCCTTCTCAGCAACTGAACTCATACTATTCTACATCTCATTCGAAGCAACCCTAATCCCAACCCTCATCTTAATCACACGCTGAGGAAACCAACCAGAACGACTTAGCGCAGGCATTTACCTTCTATTCTATACCCTAATTAGCTCTCTTCCCCTACTAGTCTCCATCCTCTACCTTCACACAAATACTGGAACCCTCCACCTACCCATTATCAAACTCACCCACCCCAACCTACCTGCCTCCTGAACAAGCTTATTATCTAGCCTAGCTCTCCTAATAGCCTTTATAGTCAAAGCACCCCTATACGGACTACACCTATGACTGCCTAAAGCCCATGTAGAAGCACCAATCGCAGGCTCCATACTACTCGCTGCTCTACTACTAAAACTAGGCGGATATGGCATCATACGAGTCACCCTCCTAATGGAGCCCGTATCCAACTTCTTACACTACCCCTTCCTCACCCTAGCCCTATGAGGTGCCCTAATAACTAGCTCTATCTGCTTACGCCAAACAGACCTAAAATCCCTCATTGCCTACTCATCCGTAAGCCATATGGGCCTAGTCATCGCTGCAAGTATAATCCAAACCCAATGATCATTCTCAGGTGCAATAATCCTCATAATCTCCCATGGACTAACCTCTTCCCTTTTATTCTGCCTAGCAAACACAAACTACGAACGGACACACAGCCGCATTCTTATCCTGACACGAGGCCTCCAACCCCTCCTACCATTGATATCAGTATGATGATTACTAGCCAACTTAACCAACATGGCCCTGCCCCCAACCACCAACCTGATAGCAGAACTAACAATTATAGTTGCCCTCTTCAACTGATCCTCCCCCACAATTATCTTAACCGGCACTGCAACACTCCTAACCGCCTCTTACACCCTCTACATACTACTCTCAACCCAACGAGGCACTCTTCCATCCCACATCACAACAACCCCCAACTCAAACACTCGAGAACATCTTCTCATAACCCTCCACATCATCCCCATACTAACACTCATCCTCAAACCAGAACTAATCTCAGGAACCCCTCTATGCAAACATAGTTTAACCCAAACATTAGATTGTGATTCTAAAAATAGGAGTTTAACCCTCCTTGTTCGCCGAGGGGAGGCCCAAGCC-------AGCAAGAACTGCTAA--TTCCTGCATCTGAGCTTTAAACCTCAGTCCCCTT-----AACTTTTAAAGGATAAGAGCA-ATCCGTTGGTCTTAGGAACCACCTA-TCTTGGTGCAAATCCAAGTAAAAG
   6.728 +s humanMito   10924 1411 + 16571 CTTTTCCTCCGACCCCCTAACAACCCCCCTCCTAATACTAACTACCTGACTCCTACCCCTCACAATCATGGCAAGCCAACGCCACTTATCCAGCGAACCACTATCACGAAAAAAACTCTACCTCTCTATACTAATCTCCCTACAAATCTCCTTAATTATAACATTCACAGCCACAGAACTAATCATATTTTATATCTTCTTCGAAACCACACTTATCCCCACCTTGGCTATCATCACCCGATGAGGCAACCAGCCAGAACGCCTGAACGCAGGCACATACTTCCTATTCTACACCCTAGTAGGCTCCCTTCCCCTACTCATCGCACTAATTTACACTCACAACACCCTAGGCTCACTAAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGAGCCAACAACTTAATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATACCTCTTTACGGACTCCACTTATGACTCCCTAAAGCCCATGTCGAAGCCCCCATCGCTGGGTCAATAGTACTTGCCGCAGTACTCTTAAAACTAGGCGGCTATGGTATAATACGCCTCACACTCATTCTCAACCCCCTGACAAAACACATAGCCTACCCCTTCCTTGTACTATCCCTATGAGGCATAATTATAACAAGCTCCATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCATACTCTTCAATCAGCCACATAGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGAAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGACTCACATCCTCATTACTATTCTGCCTAGCAAACTCAAACTACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCACTAATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTCCCTCTACATATTTACCACAACACAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCACACGAGAAAACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTATCCCTCAACCCCGACATCATTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGACAACAGAGGCTTACGACCCCTTATTTACCGAG--------AAAGCT-------CACAAGAACTGCTAA--CTCATGCCCCCATGTCTAACAACATGGCTTTCTC-----AACTTTTAAAGGATAACAGCT-ATCCATTGGTCTTAGGCCCCAAAAA-TTTTGGTGCAACTCCAAATAAAAG
   6.729 +s mouseMito   10330 1409 + 16299 ATTCTCCTCAGACCCCCTATCCACACCATTAATTATTTTAACAGCCTGATTACTGCCACTAATATTAATAGCTAGCCAAAACCACCTAAAAAAAGATAATAACGTACTACAAAAACTCTACATCTCAATACTAATCAGCTTACAAATTCTCCTAATCATAACCTTTTCAGCAACTGAACtaattatattttatattttatttGAAGCAACCTTAATCCCAACACTTATTATTATTACCCGATGAGGGAACCAAACTGAACGCCTAAACGCAGGGATTTATTTCCTATTTTATACCCTAATCGGTTCTATTCCACTGCTAATTGCCCTCATCTTAATCCAAAACCATGTAGGAACCCTAAACCTCATAATTTTATCATTCACAACACACACCTTAGACGCTTCATGATCTAACAACTTACTATGGTTGGCATGCATAATAGCATTTCTTATTAAAATACCATTATATGGAGTTCACCTATGACTACCAAAAGCCCATGTTGAAGCTCCAATTGCTGGGTCAATAATTCTAGCAGCTATTCTTCTAAAATTAGGTAGTTACGGAATAATTCGCATCTCCATTATTCTAGACCCACTAACAAAATATATAGCATACCCCTTCATCCTTCTCTCCCTATGAGGAATAATTATAACTAGCTCAATCTGCTTACGCCAAACAGATTTAAAATCACTAATCGCCTACTCCTCAGTTAGCCACATAGCACTTGTTATTGCATCAATCATAATCCAAACTCCATGAAGCTTCATAGGAGCAACAATACTAATAATCGCACATGGCCTCACATCATCACTCCTATTCTGCCTAGCAAACTCCAACTACGAACGGATCCACAGCCGTACTATAATCATGGCCCGAGGACTTCAAATGGTCTTCCCACTTATAGCCACATGATGACTGATAGCAAGTCTAGCTAATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAGGAATTAACATTATTATTACAGGTATATACTCAATATACATAATTATTACCACCCAACGCGGCAAACTAACCAACCATATAATTAACCTCCAACCCTCACACACACGAGAACTAACACTAATAGCCCTTCACATAATTCCACTTATTCTTCTAACTACCAGTCCAAAACTAATTACAGGCCTGACAATATGTGAATATAGTTTACAAAAAACATTAGACTGTGAATCTGACAACAG-GAAATAAACCTCCTTATTCACCAAG--------AAAGAT-------TGCAAGAACTGCTAA--TTCATGCTTCCATGTTTAAAAACATGGCTTTCT------TACTTTTATAGGATAATAGTA-ATCCATTGGTCTTAGGAACCAAAAA-CCTTGGTGCAAATCCAAATAAAAG
   6.730 +s fuguMito    10486 1427 + 16447 CTTAGCCACTGACCCACTATCAACCCCCCTTTTAATCCTCTCATGCTGACTCCTTCCTCTAATAATCCTAGCCAGCCAAAACCACACATCTCATGAACCAATTAACCGTCAACGAATGTATATCACACTTCTTGCCTCCCTGCAATTCTTCCTGATCCTTGCCTTCTCCGCCACAGAAATGATCATGTTTTACGTAATATTTGAAGCCACTCTAATCCCCACCCTGATCCTCATTACTCGCTGAGGAAACCAAGCAGAACGTCTTAACGCAGGTACATACTTCCTTTTCTATACCCTAGCAGGCTCTCTACCCCTCCTCATCGCACTACTACTCTTACAAAACTCTAATGGGTCCCTATCCCTCCTTATGCTCCCCCACTTGGGCCAACTTGAACTAACATCATATGCAGATAAGATCTGGTGGGCAGGGTGTATCCTGGCATTCCTAGTTAAAATACCCCTTTACGGAGTTCACCTTTGACTACCCAAAGCTCACGTAGAAGCCCCCATTGCAGGATCTATAGTGCTAGCCGCTGTACTACTAAAACTAGGGGGCTACGGCATAATACGAATTTTAGTCACCCTAGACCCCTTAACCAAAGAACTCAGCTACCCATTCATTGTCTTAGCCCTCTGAGGAGTGATTATAACTGGTTCCATCTGCATACGTCAAACAGACCTAAAATCATTAATTGCCTACTCATCAGTCAGCCACATAGGACTGGTAGTTGGAGGTATTCTCATCCAAACCCCCTGAGGATTCACCGGCGCGCTAATCCTCATAATTGCCCACGGATTAACATCATCCGCCTTATTCTGTCTAGCTAATACTAGCTACGAGCGCACACACAGCCGAACTATACTACTTGCTCGAGGTATGCAAATAATCCTCCCTCTCATAGCAGCCTGATGATTCATCGCAAGCCTCGCCAATTTAGCATTACCACCCCTCCCCAACTTAATAGGAGAACTAATGATTATTACCTCCCTATTCAATTGATCCCCGTGAACAATTGGCCTTACTGGACTAGGTACACTTATTACTGCCGGCTACTCGCTCTATATATTCCTCATAACCCAACGAGGGCCCGCCCCCAGCCACCTCCTAGCTCTTGAACCCTCACACACCCGAGAGCACCTTCTTAtcgccctccacctcctcccactaATCCTAATTATTACAAAACCAGAACTAATCTGAGGGTGAACTGCCTGTAGACATAGTTTAATCAAAACATTAGATTGTGATTCTAAAAACAGAGGTTAAAACCCTCTTGTCCACCGAA--------AGAGGTTCGCAACAATGAAGACTGCTAATCTTCATCCCCCTCGGTTAAACTCCGGGGCTCATTCGACCCAGCTTTTGAAGGATAATAGCTAATCCGTTGGTCTTAGGAACCAAAAACTCTTGGTGCAACTCCAAGTAAAAG
   6.731 +p                                QSTTW[bfdcilgeeegjd`_]^\ZYYXXYYYZYZ[Z[`efc\\belmhbbadfba`_cd^^]\[\]_dbehcekhf`^\\^]ZVONHFDCBAAA@>======>?FHILLQRTUXaghjkfchjjhcfknookkid^\]]`aZPNLFDCCDDGNPWZbihfa^^]\]beicacgejkkonjifcillhffhlljd_`a```^^XVTSRRRNNNNPTUTTSTSNNNOPSZ`a`edbhhhinooolecafgge`]]^`gjknnkkibcelooleb`b^^`c`bdijmleb`cfdghhikebebdc_`_]^bdcb`dheihcedbfcabaYXVOONNOOORRRRRQPPQSXaed^^_^bigfea[YWW\[VTRQPOOPPPQRRQMKIHGCA@@@@@@@@@@@@BDENW\\^^dflkknjifciljc^]__afabbghdgimle\RRQQONLLMLMMNW`ea^XWXX^aafhha`_afcacknoomh`aa_`bdkihinnlfdjjjia]]]]_cbimnjhjnokkjc`a`fdbfdaa\SSSSSRQRTZ[\]_djfd_^``dgdfebejiiecikeac`YWUUXXaeghd[[_a`_^cgcejgeddcedgjllfdjlhffffc_\\[[]]cdchhhinooonigcflkkkknnkjidfmnkdadknnkdadkmjcegginnmh`_beeegljeihbccbgecjmmjcaciebcbimlknooookd^_]\\WUTVVX_`ZXWWVUV[\_fiigffb^___gmkloolklga`decgf_XUVWZZbfcekkknmkdaceceecelnonnlfchjhabaeknllooollooonjhjmjb_ackooookkjc_^XX\eklicde`_YZbhijkeab^]^]``dhjnokjh`][TRSSRSW[_aijdacjlh_\ZZ[_hmnonkc``flookkicdgdjnnigbdfab[WW\b`^]\\Z[]]```cdbeidbeabdhd\YROIFEDDDDDDDEMPPPPOPRTUUVWW]flnja_]WWXXZYWWXXXZZ`cgheiigb``_ccaYPNMMMMPPZbea]\]bdegkib__dchkmlhb__ab__a_]^_^beeaa_acd__bhg`a`_^`efe`_YWVVX]_``a^]_affhlie__cdefggec\YSRSTTUW^^`^WVWXX[[ac`YWPMMMMMMMQRRSSTUUX\[WUSRRSSRQQQPPPPPVWZ_``ZXVUTSSRRRQPPQW`c`bdkmnmh_\[UQQRSTVYbgecjmjdflnnllnnkdZRIE?6-#$$%&'(()+0136=@HNPR[`aadj~~~~~~~~hhhha`~~~~~~~^_ehjnkloooonig~~cflonjb^^`bjnleacca_bdig^URKB?=7/"~~~~~"%.2357=?AIKU^bccfcZZ~]eijnkkkkookkmgd^]_`a````~]]_aginolecbijjihimhgghm
   6.732 +p                                dgijnswz|}~~~~~~~~~~~~~~~}|zyyyyzz|||}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{zxtpkffeec`\\ZWVVVVVVVUUUUUUUVVYZZ\]bgkpuz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|yyyxxy}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}{zyvvtttssttttssqqpqqqqqpppooonmjfba___^]]\\\\\\[[[[[[[ZZZZZZZYYYYYYYYZZZ]_`cfggijotx}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{{{z{|}|}}~~}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zzyzz{~~~~~~~~~~~~~{zz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|yxvvusokfba__]]]]]]]]]]]]]]]]^abcfhinrvy{{{{yyyyyyxxxxxz{~~~~~~~~~~~~~~~~~|||{{}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{{|}|||{{zxwwxxyyz{{zzywwwxxwxyyyyyyyxxxwtsrrqrrqqqqqqqqrsstuuutrrqonnnnnnnnosvxx}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}xsoje`\WWWWWWXXXXZ[`dinruvw{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|wrmhd~~~~~einsw{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
   6.733 +p                                @AAABCDDDFKPRSSSTUUV]dfc_``acgb_abahje^USRQQRVZZYYZZ]a^_`bdklieggechhcehcflkjhgcegeaYTSPJIHHIJRWWTSQPOOOPV[b_]\ZXWWX\\]\__ccb`\[VUUX\\][WVWXYXXWVTSSUVWWXY[\\\`a`bafgheilkcacgejkklgaa`ZZbfdb`cfdghd\YZ`ciia^]]\^`^__^`d_]\YXRPNNLKJJKPRW^efdadgeknmhfabdhhecginnlkmibcc`bahlnolkgd__abZWWWZcjkknliehgffcZWVUUXagdadhihffhmnkd\\b`ZXVVZZ[^]ac_XWYYXUOHGGGFFFGKLMNQQVXVUVUTSPNMLLMLMTVRPPPPPPMKJIIIIIILNT\_\][[\`gijjcZRQOMLLKKKKKJIIIIPRXaike^WWXWX_bjmia^_`cjmkcZQPPOORX[[Z`a`dknllnmicehcacknoomibcekihimjhjnonkfjjjia^]]]`imnjcba`fcacjjfknlecfdbfd``ehfaYY\`abdloolkmihejmmjheiicflnlgaahjjeadfb]][\][Z[YYYYXYUUUTSSRRTYY[]ZZailhffhiige_ZXXY\cfcffhmnmhf_ZTTSTTUVX[adgcelnlfcjmonkdadkmjcegginooollmhffhkebelnolklfdjmnlhaa`^^baekjhfced^^]_ab_`_ZZ\\\``ca_`_aaebekjjgfea_^]^dc\XWW^`b``_dddijebe`aa_bimoolkmidffgiehjnmibcb`b_\\XVTUTV^ehjnoollooonihiieiihinoooolklfbfecgjkljdfljbYVVWWZcgec_^``a`cdc]^\[[[ZYZ[]a`beabdfabaeigab]\]]aimnke\\\ekle\YYY\[]\]__dedbeac`^]^]^]\\\[^a`c``eghgc[[_^__gkkkhe_^`]\]\^dgd[XWVUSSTZ\_]^ailib[VSSSSSTUURQQMKIDDDDDCBA@<<<<<<<@BGMOOQWY^^]]WTPPQW^aacegmnoonkd\SPNNOUX_deb`aa]URPPNHFFFFE@@@@?@@@@@?:6422222222222236<=@@@HKLMPUVVSRPPOOOPUX[`_\Z[\]a_``\TRLLLMOPS[^\[WNKKKLKJJJLOVYXVRPNMMH@@?==;:998877666555556?EHMNOR\dkmihhgf`^\]_aikfdjnnlknnkdacie]\[[[ZYURRSTUUTQPQRRUY[YRROHFD?63,$,22321,#,2344~~~~~~~449<=@JS\elnmhf~~bccab\TNLLJIIIGFGFFEFFFFFFGGGHJMSU~~~~~\`ggffghgikknniheiljc~fkihehikknokklgd]\]^^[[[^~a_achjmmic`^^]ZVQMLJGC>:
   6.734 +p                                %%%%%%%%%%'''((((()*.2578=AFIKLMOOPQQQQQQQQRRTUUVVXX[]^chlquxyz~~~~~~~~~~~~~~~~~~~~~zutroonnnorstttssssstx}~~~~~~}~}~~~~~~~~~~~}|{|~~~~~{{{{{z{zywwwwwxxyyz{z{}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}{xtsqqqqqsty}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|wrqqqoommmmmmmmmmllllkjgdccbbbbbbbbbbbbbbbcccccccccccdfggghijjjjjjjjjjjjklmnnnnnnosvxyyyxvuttsrrqrrrrqqqrtty|~~~~}}}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|xxvvvuuvvvvvuuttutuutttuvwxxy~~~~~~~~~~~~{zz{~~~~~~~~~~~~~ytssstuv{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}zzzyyz{|}}}}~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zzzyyyyywurmihhgggggggffedddcccccbbbbaa`]ZVUUUTTTTTTTTTTTTTTTTTTTTTTTTTTUVVXYYYZ[\^__`aaabbfjklqv{~~~~~~~~}|{z{|}~~~~~~~}zywwvtponmljiiiiiiiihgeba`___^^^^^^^__cfghhimpqrvxyyyxwvuuuvxyzzywwwxxxyzzzyyxxy|}~~|zvvtqpppppppqrrsrrqnnmjiheeeddcbbbbbaa```````aadfgknpqvz~~~~~~~~~~~~~~~~~~~~~~~~zuqpnkgfddc``^\[[[ZZYWVVVVVUUTRQPMMMLKIEAAAAAAAAADFFFG~~~~~~~GHLQVZ^`abbbbbb~~bbaa``^\[[[ZZZZZZZZZZZZZZZZZZ[[^`a~~~~~fkoty~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{{{|~||||{yvqmhc_^\YUPKKIFA=8
   6.735 +p                                &'(((+,,./48<?ABFIKLQUZ^`aabba^^bghga`_ZYXUUW[dkoonjid`a_^ac`bbfhjdbc`a`_bihf`]\\^^^][[\[WPPPRXZZXWQNMJJJJNQQPQQPQQQUUVVUUWWVVUUWY^][Z[`gggijegc`_a_WTTTUVX[ZZZZ[]]cdfbbbhjknonlebadbelnkhcdccca[[[ZZ]]^^^edbafgjhdfcacigffgh`^\\XTSSU[`ba`ddadheknmhfabcb`ZWWZcjkkmibccafhnoonjhejmnoookkjidaceklieihhinnkfkkkljdadcadddfhcflnnjb_XUNE<2/...................7>AJOQSZZYXZZ\[\ZUUVVVVTRQPPOONNNQRSPMG>>>>>>>>>>>?CDDDDDEEEEEEEEEEEEEGIPRRRSUUUTUUUUTTV\]bd^^]\^dhe\YYZZaijeb`dgginnkjh`_]_`[YYYaimkd[[[[`bdiebeheiiejkkmgeeegkfcihcbaagicfknnjeiecjkkmkfjmlhbYY\`abdlnldb`bdlmjeffejmkknnkf^\[ZZ[_`efd^]^_ZY\\[ZZYYWVPMMMMLJJJJIIILU^``__dedbfhibZZ\bbeegiejmkdb[[aadijmnjif_]__bginooomfdjmnkfjihinooollmhffhkf_]__bghlfdjmnmicfkfdjnoollnoonjb^^afcflmia]]^ba_a~~~~~~~~~~~~~~~~~~~~~bcbginnkkkhgeb[Z^]__^aimonjieciihinnkjhaa`ba_][ZZXUTSRSV\bekljcflnle]\[XX[Z^_glnolfcillkhehjkliabb[[XX`ec`b_`^Z[beeabb`[Z^^c`^\WWX[[`ffeedhhcfkigc][[\_glke\SRRRXZcikknllonlebcb^]_`ecaba\TQLLKKIIIJKNSUWWZ__c`bdgf`XOJC@????>>>>>>>>????@BCCCDENUYXSPNMLLLMNNNOOOOOPW\ciiehijc^VUUVWXZ]YWWYZaecea^ZZ[^aijebejkidaaa`[XVUUY[[\^ZSSROKIDDDBAA@@@AABBBBEFFFEECBBBBBCDFGHJMSUW`b[RQRRQQRQQQOMLLLLLLMMMOONOQVX^^ac^[TLIIIIIIIJKLNMMIA?=<<<<<<===>>@ACDDDJLQQPPQSWXXWVUTTTTYZ^egd`bbgjlnihihgbdfefgmlfdjnnlknnkdacig__^`cjke\RPIHHHGGGGHHORRRQNLKFC=41~~~~~~~~/))'%$"""""""!""""##%,.....+$*#,4:;<<======@AAABBCCCCCBBA<:3333'#$&0'#$&09AFHNRXZ\ZSPIG@7-##,246=@GJRSKHA85.,++*)('&"$%,.58BKSWWVROJD@<;963.)
   6.736 +p                                #$%%%())+,159<>?CFHIMRW\`ehklllmpqqrrrrqqrrrsw|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{{{yvvvvwxxxvtqpnnnnnnnnnnnnnnoooooopppppppqqqqrrw|~~~~~~~~~~~~~~~~}}|zzzzz||~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}||{|}~~~~~~~~~~~~~~~~~~~~~~~~~~~}zyyz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|wsnid`[VUSSSSRRRRRRRRRRRQQQQQQQQQQQQQPPPOOOOONNNNNNMLLKKJJJIIIIIIIIHGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGHHIJLMMOPPQUY\]^acdimqtvw|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|wwvvvvwxz{{z{|}|}~~~~~~~~~~~~~~zyxwwwwx}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zxuutuuz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|}~~~~~~~~~~~~~~~~{zz{~~~~~~~~~~~~~~~~~~~~~~~zzxuttsssrqpnkgcb`]YXXXXXXXXXXXWWWWWVUSOKFBA@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@AAAABFKNPQRTTUUUUUUUVWYYZZZ\\^_`abbbbchlpsuv{~~~~~~~~~yuttttsssqonmjgfddb``____________^^]]\\\\\\\\]]^cglptvwwwxzz{zzzywsonnnllllkkkkjjjjjjijiiigeddddcbbbaaaaa`^^^]]]]]]^^^^_______________`aaaaaaaabdeilopprsx}~~~~~~~~~~~~~~~~~~~~~~{vqlhgeb^][[ZWTPKFB=<::88888777654333320-)~~~~~~~~('&%#"!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!#$(-1467;?BDDEEEEEEEEEIMQSSX]aegiijjjjiiiihgeb^YZZZZZZZYYXWTPKGB=8762.*%
   6.737 +
   6.738 +a
   6.739 +s chickenMito 13250 1332 + 16775 GAAAGCATTGCCACCCACTGAGAATGACAATTTATCCCCAACTTCAAGATCCCCATCTCCCTAAAAATAGACATATACTCCATAATATTCTTCCCCATTGCACTATTTGTAACCTGATCCATCTTAGAGTTCGCAACATGATACATAGCATCCGAACCATTTATTACAAAATTCTTTACCTACCTACTCACCTTCCTCATCGCCATATTAACACTAACCATCGCAAATAACATATTCCTCCTATTTGTAGGATGAGAAGGAGTAGGAATCATGTCATTCCTTCTCATTGGATGATGACAAGGACGAGCTGAAGCCAACACAGCTGCACTACAGGCAATAATCTACAACCGAATCGGAGACATTGGCCTCATCCTAAGCATAGCATGACTAGCCTCTTCCCTAAACACCTGAGAAATTCAACAAATCACCCACCCAAACCAAACACCCACCCTCCCCC------TCCTTGGCCTAATCCTAGCCGCCACAGGAAAATCCGCTCAATTTGGCCTTCACCCATGACTTCCAGCAGCAATAGAAGGCCCAACCCCTGTCTCCGCCCTACTCCATTCCAGCACAATAGTAGTTGCTGGAATTTTTTTACTCATCCGCACCCACCCCTTCCTGTCATCCAATAAAACAGCCCTGACAACGTGCCTATGCTTAGGTGCTCTATCAACACTCTTTGCCGCAACATGCGCTCTCACTCAAAACGACATCAAAAAAATCATTGCCTTCTCCACTTCAAGCCAACTAGGCCTCATAATAGTCACAATTGGCCTAGACCTCCCCCAACTAGCCTTCCTCCACATCTCAACCCATGCCTTCTTTAAAGCTATATTATTCCTATGCTCCGGCCTAATTATCCACAGCCTCAATGGAGAACAAGACATCCGCAAAATAGGATGTCTACAAAAAACCCTCCCAATAACCACCTCCTGCCTAACCATTGGCAACCTCGCTCTAATAGGAACTCCATTCCTAGCAGGCTTCTACTCAAAAGACCTGATCATCGAAAACCTAAACACCTCATACATCAATACCTGAGCCCTCTCACTTACACTACTTGCCACATCTTTCACTGCAACCTACAGCCTCCGCATAACCTTACTAGTCCAAACAGGACACACACGAACCCCCAGCAATCACCCCATTAACGAAAACACCCCCCCAGCCATTCTCCCAATCATACGACTAGCCCTTGGCAGCATTATAGCAGGCCTATTAATCTCATCCCTAATCCTCCCCCCTAAAACCCCTCCAATAACTATACCCACCATCACAAAAACTGCTGCCATCATTGTTACAACCCTAGGAATTATCCTAGCCCTAGAACTC
   6.740 +s humanMito   12514 1335 + 16571 GAAGTTATTATCTCGAACTGACACTGAGCCACAACCCAAACAACCCAGCTCTCCCTAAGCTTCAAACTAGACTACTTCTCCATAATATTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAGAATTCTCACTGTGATATATAAACTCAGACCCAAACATTAATCAGTTCTTCAAATATCTACTCATTTTCCTAATTACCATACTAATCTTAGTTACCGCTAACAACCTATTCCAACTGTTCATCGGCTGAGAGGGCGTAGGAATTATATCCTTCTTGCTCATCAGTTGATGATACGCCCGAGCAGATGCCAACACAGCAGCCATTCAAGCAGTCCTATACAACCGTATCGGCGATATCGGTTTCATCCTCGCCTTAGCATGATTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAACGCTAATCCAAGCCTCACCC---CACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAGGTCTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCCCAGTCTCAGCCCTACTCCACTCAAGCACTATAGTTGTAGCAGGAATCTTCTTACTCATCCGCTTCCACCCCCTAGCAGAAAATAGCCCACTAATCCAAACTCTAACACTATGCTTAGGCGCTATCACCACTCTGTTCGCAGCAGTCTGCGCCCTTACACAAAATGACATCAAAAAAATCGTAGCCTTCTCCACTTCAAGTCAACTAGGACTCATAATAGTTACAATCGGCATCAACCAACCACACCTAGCATTCCTGCACATCTGTACCCACGCCTTCTTCAAAGCCATACTATTTATGTGCTCCGGGTCCATCATCCACAACCTTAACAATGAACAAGATATTCGAAAAATAGGAGGACTACTCAAAACCATACCTCTCACTTCAACCTCCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTTCCTCACAGGTTTCTACTCCAAAGACCACATCATCGAAACCGCAAACATATCATACACAAACGCCTGAGCCCTATCTATTACTCTCATCGCTACCTCCCTGACAAGCGCCTATAGCACTCGAATAATTCTTCTCACCCTAACAGGTCAACCTCGCTTCCCCACCCTTACTAACATTAACGAAAATAACCCCACCCTACTAAACCCCATTAAACGCCTGGCAGCCGGAAGCCTATTCGCAGGATTTCTCATTACTAACAACATTTCCCCCGCATCCCCCTTCCAAACAACAATCCCCCTCTACCTAAAACTCACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTC
   6.741 +s mouseMito   11918 1335 + 16299 GAATATATAATTACAACCTGGCACTGAGTCACCATAAATTCAATAGAACTTAAAATAAGCTTCAAAACTGACTTTTTCTCTATCCTGTTTACATCTGTAGCCCTTTTTGTCACATGATCAATTATACAATTCTCTTCATGATATATACACTCAGACCCAAACATCAATCGATTCATTAAATATCTTACACTATTCCTGATTACCATGCTTATCCTCACCTCAGCCAACAACATATTTCAACTTTTCATTGGCTGAGAAGGGGTGGGAATTATATCTTTCCTACTAATTGGATGATGGTACGGACGAACAGACGCAAATACTGCAGCCCTACAAGCAATCCTCTATAACCGCATCGGAGACATCGGATTCATTTTAGCTATAGTTTGATTTTCCCTAAACATAAACTCATGAGAACTTCAACAGATTATATTCTCCAACAACAACGACAATCTAATTC---CACTTATAGGCCTATTAATCGCAGCTACAGGAAAATCAGCACAATTTGGCCTCCACCCATGACTACCATCAGCAATAGAAGGCCCTACACCAGTTTCAGCACTACTACACTCAAGTACAATAGTAGTTGCAGGAATTTTCCTACTGGTCCGATTCCACCCCCTCACGACTAATAATAACTTTATTTTAACAACTATACTTTGCCTCGGAGCCCTAACCACATTATTTACAGCTATTTGTGCTCTCACCCAAAACGACATCAAAAAAATCATTGCCTTCTCTACATCAAGCCAACTAGGCCTGATAATAGTGACGCTAGGAATAAACCAACCACACCTAGCATTCCTACACATCTGTACCCACGCATTCTTCAAAGCTATACTCTTTATATGCTCTGGCTCAATCATTCATAGCCTGGCAGACGAACAAGACATCCGAAAAATAGGAAACATCACAAAAATCATACCATTCACATCATCATGCCTAGTAATCGGAAGCCTCGCCCTCACAGGAATACCATTCCTAACAGGGTTCTACTCAAAAGACCTAATTATTGAAGCAATTAATACCTGCAACACCAACGCCTGAGCCCTACTAATTACACTAATCGCCACTTCTATAACAGCTATGTACAGCATACGAATCATTTACTTCGTAACAATAACAAAACCGCGTTTTCCCCCCCTAATCTCCATTAACGAAAATGACCCAGACCTCATAAACCCAATCAAACGCCTAGCATTCGGAAGCATCTTTGCAGGATTTGTCATCTCATATAATATTCCACCAACCAGCATTCCAGTCCTCACAATACCATGATTTTTAAAAACCACAGCCCTAATTATTTCAGTATTAGGATTCCTAATCGCACTAGAACTA
   6.742 +s fuguMito    12107 1338 + 16447 GAATCTATCATCACTAACTTAAACTGAATAAACACCCTCACCTTTGACATCAACATCAGCCTTAAATTCGACTCCTACTCAATTATCTTTACCCCAGTAGCACTATACGTAACCTGATCCATTTTAGAATTTGCATCCTGATACATACACTCAGACCCATTCATAAACCGATTCTTTAAATACCTTCTGGTCTTCCTAATTGCAATAATTATTCTTGTTACCGCCAATAACATATTTCAACTCTTCATCGGCTGAGAGGGGGTTGGTATCATATCATTCCTTCTTATCGGCTGATGATACGCACGAGCAGACGCTAATACAGCCGCCCTACAAGCAGTCATCTATAATCGAGTCGGAGACATTGGATTAATTATCGCTATAGCTTGAATAGCCACCCACCTAAACTCCTGAGAACTACAACAAATTTTCTTTTCCACTAAAAACATAGACATAACCCTCCCATTAGTTGCCCTGATCTTAGCCGCAACAGGCAAATCAGCCCAATTCGGCCTTCATCCGTGACTTCCTTCTGCAATAGAAGGTCCTACACCGGTCTCTGCCCTACTCCACTCCAGCACTATAGTTGTTGCAGGAATCTTCTTAATAATCCGCATCTCCCCCCTCTTAGAAACCAACCCAACAGCCCTCACACTCTGCCTATGCCTAGGAGCCCTAACCACCCTATTTACCGCCACCTGCGCCCTAACCCAGAACGATATCaaaaaaaTTGTAGCTTTTTCAACTTCCAGTCAACTAGGCCTAATGATAGTCACCATTGGCCTAAATCAGCCCCAACTTGCCTTCCTGCACATCTGCACCCACGCTTTTTTCAAAGCCATATTATTCTTATGCTCTGGGTCTATTATTCACAGCTTAAATGATGAACAAGACATCCGCAAAATGGGAGGGATACACCACTTGACCCCTGTTACCTCTTCATGCCTAACAATTGGCAGCTTAGCCCTGACCGGAACCCCCTTCCTAGCCGGCTTCTTTTCCAAAGATGCCATCATCGAATCTTTAACCACCTCCCAATTAAACGCCTGAGCCCTATGCCTCACCCTCCTAGCAACTTCTTTCACAGCTATCTACAGCCTACGAGTCGTATTCTACGTATCCATAGGCCACCCTCGCTTTAATTCCCTTTCACCAATCAATGAAAATAACCCATCTGTAATTAACCCTATCAAACGACTGGCATGAGGCAGCATTATTGCTGGCCTATTAATCACCACAAACCTTCTCCCAACAAAAACACCTGTAATATCAATACCTATAGTTGTTAAACTTACTGCTCTTATCGTCACAATCTTGGGACTCCTAATTGCCCTAGAATTA
   6.743 +p                                Y[[YY^`^\]\WWXVWWYbdcimnonlf^][YUURQQQQRY\\XVVWWXWTTUVX`dhmlec]SQONNNW`da]]_bhhdbdc\[ZYXWSSRRSV^ehjcYWUUUWWX`cbilnlecfc`cdcikiegijfda[VTTV^djkkkkjebeknooonihiihinlfcghibYY_`a[[[`achd[RHEEEEEIJMPWY__agimkkmiba[XXWQONMMMMMRSY[\cfjihecijca_bghkeacellfcginomke\YYYY`dabdijkknnmjb_`aa_`aggbca^]__chiiechlib^^agecimnjdfa^_`agheknoleb`bahjknmfdjjfdbccbdhjjjfknnigdhheimmhfacekjb]]^^`\YY`ff`_cih`][WWY\db_`_YXZ^`inoooomi`]]\]`^]WNEDA?>>===<<<=>>>>>>>>>>>>??@CIKOPQS~~~V\^[YYagjjigc^]^]]``gijid\\dige`abeloolebdggdbaddbekkkkebaainomh````hmnkdadknnkkihdba_cb_bdklebeknlebelnmjcfknonkkjdggcejlkecgecinnkkihd`acb`cklhaahjjjehijig_][ZYTLKKHHHHHHHGFEDDDDDEEEEEFFFFEEEEGIQX[[aea_``b_]][ZZ[Z`bddaZY\\]]\]djicZY[[`cbdb`bcadc`ceddddjnooomfccbccfkicbahjkkjkjecggcflkkjcfijnonigceheknklnolfcge`_baeebdfabeijkkkknnnkloooookkkkkejlmnooooonjhjnnlfcgimkknjhilfcjmnmidffgjheilmjc```_db`cknkcabc[YXWVQOMLLLRT]cflkkmiegcacifddded\TQJB@???????@ACDGPYbhda[[`fhgceic``_c``a^VUUVXZZ_``bjjjibb[YWXWW`fjkkknmhfaceiiicfkjb_^_bjnonia^_`cjkda[[`bafdbd_[UUSSRRSTSSSRSPPQY^__^`cknllooonhffbZPPPSZ]egdhhcflnlebc][[ZXXXUUSMKJKLMOW[[biic\\ac^[XSQKHA@@@@@?????AAAAAAADMSVZ[\]XWVTTTTSTTTSQQNMNPV^egjknmhfefe]]XVTRQRTVXVV_bbb`^]\]_^cdflnkkjcejg``chikkkeab`aa`hlnkicZWPMLF=4***))))))))((&&&&%$###""""""""""""##%+,/699::::;<==>?BJNNOPQYadglhge_VTRQPPOOOOOOPPYbggcZZZ\dca\\ccaelnkcacfa
   6.744 +p                                hiiijmnoopppprrtuy{}~~~~~~~zvusplkiiiiiiiiihhhhhhhhhhhinsx|~~~~~~~~~~~~~~~~~~~~~~~~}|}|}|{{zz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ytssstuv{~~~~~~~~~~~~~~~~|{zwsrqpppqrsvxy}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|wrnihfffedb_ZZXUTTTTTTTTTTTTTTTTTTTTTTTUVWWWXY]~~~adeffgkpsuvvvuuvvvxy}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|xsnie`__^^^^^^^]]]]]]]]]]]]]]]^^^^^^`aegijmoopqqsttuuuvxx|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~||zzywssrrsuvz~~~~~~~~~~~~~~~~~~~~{vqmllklkllmquxz{~~~~~~~~~~~~~~~~~~~~~~~|yxxy|}~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}}{{zxwvtponmmmmmmmmmmmnnswz|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}{xwusrrqqqpmmmmmmopprrrrrrrrqpnkjifbaaaaaaaaaaaaaaaaabgjmoorttwyy}~~~~~~~zzxxxy}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}{wsnje`[ZYUQMLLKKKKKJJJIHFEDDCA@@@@@@?????????@@@ABBBBBBBBBBBCCCDHLOPQQRVZ\]^^^^^^^^^^^^^^^__``eimopprswyz{{{~~~~~~~~~~~~
   6.745 +p                                SRRQQT\_^\\]\\[\_dedb\[YYTLC@?>=<<<;;;;;;;<=?BKQSWWVVVVWVUVVVXXZ[\\ejjd[RRRWY`dhjnnlknnkjibc`^][\^^fjg`a```_ec`bdchecikknmjcfkkecggfa`ZWWYafihebcb[WVV]_^b`^_`_\\]aa`[VUVXY`chca^_]^efcflnonkg_^`bghhcdb_`egllg``][TRSTUTUW[[^fg`abbefdciljjgd`_be``^]^aaefdjmlha^_`ahnnkkjiechhdgdaba\YZZbikib^]__dijjje_^\\[\_hmnkehecikkkknnnnmha`YVVXY^_^`gdac_^`_cgljkkkjdflnigdhhdgdacc__bjnmhf`WUUVWZcji`WMD:866555555555579;BEKMV_dd^ZYYZ`dhkgfeaYXYXVONNMMLIB9776555544321.'$$$"~~~##"*+,.1:CLSWXYZ\]`hic`a\YZagge`abdjfcgdadggdbaddacb`cidbaahnnh`]\\\^ekjdadknnkkhgb`^]_bbbccjmnlfciihinoonkjicdcackmlicfklkecgecijehihga]]]]`bjnonnleb\SOMLKKFD?64333333333333333344445566666666678:<DLPX`ege]SJGGEDCCCCCCCCCCCCEGGMOQY]\YXXahkjdacdaeecffeeedjnooomfccbccfliccb~~~~~~~~~~~~~~~~~dfjkoonigcflooolloomfdiljiebefc_`[[_a`\[\\\_`_cjnlfcghjjicflnnmkf`_bffgjejjkkkkebaeegkfcijhcehb_[[\\_aiia_WURQQRV\]ejkkmlebee`YYXVUUUZ`chijliegc`ce_`abdkmkjhbcciljc]\\]^`ba_b^__]]`^^\YXXXY[]^]_cfbeijnkkkklfcghiegc[Z^^]^dggc`ZZ^_^`bfgd\\chhfaceloonia^_`ckmheaagmoonkcZWUTTTV[]_fe`afkmmie_VVWXY[`dloonihhebca[[adigcd`XX[[bbaeb__\YYYYYVOMMMOVYbfcfaXPPPSY[`a[XQONOOTUTTUYZ[]`hlhfa`[VVY[_`ZXXXYYYVONLJJIIIJMT]dfijjbYVTRNLIIHHGFFEDDDEFFGHLMMNQSSUU^fgbcbZZXTSST[^^ac^VTSSTVYYTLH@>=;:::960//-,,,,++++*))))))))))))))))))))*+,-........................18:CIKMUYYY[\\[[[YYYZZ[[ZXUQQOLKJIIIIIHFC>:500.+
   6.746 +p                                aaaaaaaaaaaaaaaaaaaaaa```_^\\\\\\\\\\\\\\\\\]]__```aaaaaaaaccefilnortuvvuuvwx}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~}|}~~~~|{|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|xwwwwvvwxy}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}yxxxxxxxvtplgba`___________`cefghikmnnnnnnosw{}}}}{wwwvurrqqqpomjiiihhhhhhhhhgfdcb_~~~\\\]^acdhlopqqrw|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vrmhc_ZUPOONMJFB=876555555555555555555555555555555556;@DINSW\_acceffffgghilmnprruvvyzz{||{{{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zyyz}~~~~~~~~~~~~~~~}zyyz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{{{{{{zzzz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|||{||zzzxwvtssssrqqqqrvyz{{||{zzz|||}}|{xwwwwxxwwx{}}~~~~~~~}{xxwwwwuuuvvvusppnnnmmmmnsx}~~~~~~~~{vvtsrplhgeeeeeeeeeffffgggggggffffeddbbbbbbaaaa``_____^^]ZWVVUUUUUTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTUUUVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVUUUUUUUTROKKIFEDCCCCCB@<84/**(%
   6.747 +p                                $&&''+.00467789;<======>>>>>>>>>>>>>>>>>>>>>>>>>>???@AACDGIJKLMQSTTVW\_bc`bbaghc`bb_ac`a`_b^_`abimoomhababahjcacdchecijjjb__bilhfa^ZZ^]VVX]aghgdghdbeknooonhffb_`ec[XXXWWVV]_fdbadegkicddbed_^`^achjnkjhfa`^_\SPOMMLLKLLU\_gjjkebeecffecijca_bgiljehjnooollooonmkdb`_ccaddbddcilmkeaa`[YYY_a`gkibcbeloooooonlebeloooonkehebeedilmlecgdb`bahjkooookc]]]^^]`cacb\\cjigdhhdgdacc_`a`cb_`fie]ZZ`gkg__]VMKIHHHHIJLNONNOSV_fecjnmjb^^_b_WTMDA?80.,+*))&%%%%%%%%%%%%%%%%%%%%%%#"$#"(**,,,,,.067777:@ADLQRRSUWX~~~~~~~~~~~~~~~~~~~efebcb`bd___`hmnia]]]]`dcgcacknnkjge___^ba^_aadkmljejihinooollnnkdadknoooooookklfdjnokkkknolknjiecfcelkklg_^[XWYZZ\]^[[\cfb_^\\]\]]]ZWVXWVVQOOOOOOOONOQT]dgjdadjg`]^\ZZ[[adgidacd^\[YYZY[XVVX_gmnmhffb`bb_aa^`abhiejmlecbbbbddbimmh_\\\[]^]`hihcackoolloonigcdgcegcflnlfbea_`a`dedac_`a`cc``_^a`^`a`fdbghjkoooooooonkfjihinmh_\\\\_aiihinllmlibde_ZWWYY\_efcbefgkfchebfcacg`WTRQQQRSTW_glkknkkmiegc`ce_``acfabdd]ZXX]]XUUSRQQQQRRRTUVVXY_^]^^\\]]a`bdf`a`_bghjkookdadibYVUUSTVV\^`_[ZZZZ\_dec[[^^ab`acfb^^bghhhhibYXX\ainoonh_\[ZYYYZZY[^\\][XWWUUW]`bjnklooonjhijh`XXY\]ccadgdadcgd]][YYXWWXXYVOLLLNPX[VSQMD;;::::761...............469BHKQSTY]fkmh_\YWWWX[\\ZXQQLLLLNQRWY[ceeefha_XVTSSTTW^_]]\]_a```edbefgljdflkjiaYXZ]^^_`[RPNNOOX\\]\VUUTTVWXYXZXSQOOOOONMKHHHHHFFFDBA@@@@@@@ABEFHLOUX[YQOMLLLKKKLMNPTVX_``ghdf`ZZXVUTT]eiif_^`_]^]_aijcacjgeaagfdc^VLC:775
   6.748 +p                                #%%&&*-//356678:;<<<<<<<<<<<<<===================>>>?@@BCFHIJKLPRSTVV[_acdghimoqrtvvyzz}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{{yvrqooooooopqqqqrtuvvuuttrokgfddc`]YTOKFA@@@@???>>>>>>>>>>>>>>>>>>>>>>>>>>>ABBDEEFFHHKLMMNQSSX\_aaeikkpuz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|xwwwwwwwwwwwwwvvvw{~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|}|}}{{|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~yxxxvssqqpoooppqtvvvwxyzzzzzz{{}~~~~~~~~~~~~~~~~~~~~~~}||||~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~yxvvvwwvvvuuuutttttuz~~~~~~~~~~~~~~}xssrrrrrqqqpmmkkjhgfdcb_^^^^]\ZYYYYYYYYYYXWWWWWVVUUUUTTTTTTTTTTTTUWW[^``cefjnpqrrrqpppppsttuttsssstvxy|}~~~~~~~~~~~~~}}}}~~~~~~~~~~~~~~~~~~~~~~~~~zuututttsroommmmllkkjiihhhhhhhgggfffeeeeccb```_^\[[[ZYYYYYYYYYZZ[[[[\\\\\\\\\\\\\\]^_dhkmnnopppqpqqppqqvy{}}|}~~~~~~~~~~~~}zvrqqpolhc_ZUTTT
   6.749 +
   6.750 +a
   6.751 +s chickenMito 16463 312 + 16775 GCCTCAGGATAAGGATCCGCAGCTAATGACACAGAATAAACAAAAACCACCAACATCCCCCCTAAATACACCAAAAATAACGCCAAGGAAACAAAAGAAACACCCAAACTCACTAACCACCCACATCCTATCACAGACGCTACCACCAACCCCACCACCCCATAATACGGCGAAGGATTAGACGCCACAGCTAAAACCCCCAGCATAAAACAAATCCCAAGAAAAATCACAAAATAAGTCATATTATTCCCGCTTGGTTAGACCCCAAGGACTACGGCTTGAAAAGCCATTGTTGT-TCTCAACTACGGGAAC
   6.752 +s humanMito   14432 311 + 16571 GCCTCAGGATACTCCTCAATAGCCATCGCTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAAATTAAAAAAACTATTAAACCCATATAACCTCCCCCAAAATTCAGAATAATAACACACCCGACCACACCGCTAACAATCAGTACTAAACCCCCATAAATAGGAGAAGGCTTAGAAGAAAACCCCACAAACCCCATTACTAAACCCACACTCAACAGAAACAAAGCATACATC--ATTATTCTCGCACGGACTACAACCACGACCAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAAC
   6.753 +s mouseMito   13828 311 + 16299 GTCTCTGGATATTCCTCAGTAGCTATAGCAGTCGTATATCCAAACACAACCAACATCCCCCCTAAATAAATTAAAAAAACTATTAAACCTAAAAACGATCCACCAAACCCTAAAACCATTAAACAACCAACAAACCCACTAACAATTAAACCTAAACCTCCATAAATAGGTGAAGGCTTTAATGCTAACCCAAGACAACCAACCAAAAATAATGAACTTAAAACAAAAATATAATTATTC--ATTATTTCTACACAGCATTCAACTGCGACCAATGACATGAAAAATCATCGTTGTAATTCAACTACAGAAAC
   6.754 +s fuguMito    14029 311 + 16447 GCCTTAGGATCCTTATCTGCAGACAGCGCTGacgaataaataaacacaaccaGTATACCCCCCATATAAATCATTAACAACACCAAAGACAAGAAAGTTCCCCCGTGCAAAACTGAAGCCCCACAGCAAAGAAGTGCAACCAGCACCAAATTGAAAACTCCATAAAAAGGAGCAGGATTTGTAGACAACACAATTATTACAACCAACATCcctaataaaagaaaaacaagcgcATAAAAC--ATAGTTTCTGCCAGGATTTTAACCAGGACCTATGGCGTGAAAAACCATCGTTGTTACTCAACTACAAAAAC
   6.755 +p                               XY^ccbgimmiceijnlfdjmlfciiejjeiifknnnnnkjhffdikjkjiechg_]]^^`bjihimihiiiecbbbcflonigb_^XVSRNNLLLLNSTTTUUTSSQPOOQRSSSSUTTTT\_][[ZVVTRRQQRTW`hjkmhf`\[WVVZbeeeca_bdlnjhjnniheijjiie\YVUXX\[[]^][ZXWVUSSRRQPPNMMLKKKJJJKKMSWXWWWVVVVVVTUUVUVXWTTUYa~~da`YPNKKKNV\\XXUUXYaffc_`flnkkkkonjejmmfdcccbelooolknjb_ackkkjcZQG>>==;
   6.756 +p                               RSWZ\]afjmopty~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~||{zzzz~~~~~~~~zvuuuvvwxxx{||}~~~~~~~~~~~~~~~~~~~~~~~~~~~}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~yxxwwwwwwwvsponmllkkjihgggfffffffffgjlnnoppqqsssssssssttttuy}~~~~~~~}yxxxz{{{{{{}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{{{zx
   6.757 +p                               ~~~~~~~~~~~YVVVWWVVWZa_WUSSSRRTV^b`bd_]\^_^^]aa_aefdchg_]]^^`bihgge]UTQPONMLKHHEEEEEEEEEEEEEEEEEEEEEEEFFFKMMMNMHFDDCCCDDDFIIJJSWXYTTRLC9766667889;>>>??@@@@AABCDGPTQOMMNTUX`cddcaa`]VNKIDA@?>>>>>=========<<;8888887776666655555554444444444211-"$"%.24555666666665555566677777888899999:::::9999988762*%%'(******)('''&$
   6.758 +p                               =ADGHHHHHHHHHHHIIIIIIIIIIIIIIIIJMNORSTTUY]`abeghlpsuvz}~~~~~~~~~{vqlhgedddca]YXVVVVVVVVVVVVVVVVVVVVVVVVVVWWWWWWWWWWWWWWWWXXYYYYYYYYYYYYYXXXXYYYYYYYYYYYYYYYZZ]_```````````````__]\[YUQLKJIIIHHHHHHHHHHHHGEBAA@@@@?><;;;;;:::::::::::::::::::99999999999999999888888888888888888888888888888888888777653/+++++++++**('''&$
   6.759 +p                               &*-/0479:;;;;;;<<<<=@ABEGGKMOOOOOPPQQQQQQSTTTTTTTTTTTTTTTTTTTTTTTTTTTSQPPNLLLKKKKNNOPQQPPPOLLLMLKJJHGFA=643333333333334444444455555454444444444566666678:ACDDFGILU[]]\\bgikicdebZZXQOMLJDBA?:87666554433332210/.-,,,,,,+++++++++++++,,.7>FKMNOQV~~VQMKJIHHHKLLLSUZYZZ[adhiicfkhgbdga^]_~~~~~~~~~~~~~~~~~WVX\dijnonldb`bdk
   6.760 +p                               %),./368999::::;;;;<?@ADEFJLNNNNOOOPQQQQQSSSTTTTTTTTTTTTTTTSSQONMLKIFB=87655533222222211111000000000//.,)(((((((((((((((((((((((((((((((((((((((((((((())-/01348=AEHJKKLLLLLLLLLLLLLLLLLLLLLLKKKJJJJJJJJJJIIIIIIIIIIIIIIIJJJJJJJKKKKLLMQUWYYYZZ[~~[[[[\\\\\]^^_acccddejnruwx|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
   6.761 +
   6.762 +a
   6.763 +s chickenMito 14904 1124 + 16775 ATTCGAAAATCCCACCCCCTACTAAAAATAATTAACAACTCCCTAATCGACCTCCCAGCCCCATCCAACATCTCTGCTTGATGAAATTTCGGCTCCCTATTAGCAGTCTGCCTCATGACCCAAATCCTCACCGGCCTACTACTAGCCATGCACTACACAGCAGACACATCCCTAGCCTTCTCCTCCGTAGCCCACACTTGCCGGAACGTACAATACGGCTGACTCATCCGGAATCTCCACGCAAACGGCGCCTCATTCTTCTTCATCTGTATCTTCCTTCACATCGGACGAGGCCTATACTACGGCTCCTACCTCTACAAGGAAACCTGAAACACAGGAGTAATCCTCCTCCTCACACTCATAGCCACCGCCTTTGTGGGCTATGTTCTCCCATGGGGCCAAATATCATTCTGAGGGGCCACCGTTATCACAAACCTATTCTCAGCAATTCCCTACATTGGACACACCCTAGTAGAGTGAGCCTGAGGGGGATTTTCAGTCGACAACCCAACCCTTACCCGATTCTTCGCTTTACACTTCCTCCTCCCCTTTGCAATCGCAGGTATTACTATCATCCACCTCACCTTCCTACACGAATCAGGCTCAAACAACCCCCTAGGCATCTCATCCGACTCTGACAAAATTCCATTTCACCCATACTACTCCTTCAAAGACATTCTGGGCTTAACTCTCATACTCACCCCATTCCTAACACTAGCCCTATTCTCCCCCAACCTCCTAGGAGACCCAGAAAACTTCACCCCAGCAAACCCACTAGTAACCCCCCCACATATCAAACCAGAATGATATTTTCTATTCGCCTATGCCATCCTACGCTCCATCCCCAACAAACTTGGAGGTGTACTAGCCCTAGCAGCCTCAGTCCTCATCCTCTTCCTAATCCCCTTCCTCCACAAATCTAAACAACGAACAATAACCTTCCGACCACTCTCCCAAACCCTATTCTGACTTCTAGTAGCCAACCTTCTTATCCTAACCTGAATCGGAAGCCAACCAGTAGAACACCCCTTCATCATCATTGGCCAAATAGCATCCCTCTCTTACTTCACCATCCTACTTATCCTCTTCCCCACAATCGGAACACTAGAAAACAAAATACTCAA
   6.764 +s humanMito   14756 1124 + 16571 ATACGCAAAATTAACCCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCCCCACCCCATCCAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTAGCCATACACTACTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCACATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTGCAACTATAGCAACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAGGGGCCACAGTAATTACAAACTTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTGAGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCTTACCCTTCATTATTGCAGCCCTAGCAGCACTCCACCTCCTATTCTTGCACGAAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAATGACATTAACACTATTCTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCTTAAACACCCCTCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCCCTAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAATCCCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATACTTCACAACAATCCTAATCCTAATACCAACTATCTCCCTAATTGAAAACAAAATACTCAA
   6.765 +s mouseMito   14153 1124 + 16299 ATACGAAAAACACACCCATTATTTAAAATTATTAACCACTCATTCATTGACCTACCTGCCCCATCCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACACTACACATCAGATACAATAACAGCCTTTTCATCAGTAACACACATTTGTCGAGACGTAAATTACGGGTGACTAATCCGATATATACACGCAAACGGAGCCTCAATATTTTTTATTTGCTTATTCCTTCATGTCGGACGAGGCTTATATTATGGATCATATACATTTATAGAAACCTGAAACATTGGAGTACTTCTACTGTTCGCAGTCATAGCCACAGCATTTATAGGCTACGTCCTTCCATGAGGACAAATATCATTCTGAGGTGCCACAGTTATTACAAACCTCCTATCAGCCATCCCATATATTGGAACAACCCTAGTCGAATGAATTTGAGGGGGCTTCTCAGTAGACAAAGCCACCTTGACCCGATTCTTCGCTTTCCACTTCATCTTACCATTTATTATCGCGGCCCTAGCAATCGTTCACCTCCTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAATCATATTCTTAATTCTCATAACCCTAGTATTATTTTTCCCAGACATACTAGGAGACCCAGACAACTACATACCAGCTAATCCACTAAACACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTATCCTAATTTTAGCCCTAATACCTTTCCTTCATACCTCAAAGCAACGAAGCCTAATATTCCGCCCAATCACACAAATTTTGTACTGAATCCTAGTAGCCAACCTACTTATCTTAACCTGAATTGGGGGCCAACCAGTAGAACACCCATTTATTATCATTGGCCAACTAGCCTCCATCTCATACTTCTCAATCATCTTAATTCTTATACCAATCTCAGGAATTATCGAAGACAAAATACTAAA
   6.766 +s fuguMito    14353 1124 + 16447 CTACGCAAAACCCACCCCCTACTAAAAATCGTAAACGACATAGTAATTGACCTTCCTACCCCCTCAAACATTTCCGCCTGATGAAACTTTGGCTCTCTACTCGGATTATGCCTTATTACACAAATCATCACAGGACTGTTCCTTGCAATACACTACACATCCGACATCTCTACCGCCTTTTCATCCGTAGCCCACATTTGCCGAGACGTAAACTACGGCTGACTAATTCGCAATCTACACGCAAACGGTGcctcattcttttttatttgcttaTACTCCCACATCGGCCGAGGTCTTTACTATGGCTCTTACCTAAGTAAAGAAACCTGAAACGTAGGGGTAGTCCTCTTACTTTTAGTAATGGCCACCGCTTTCGTAGGCTACGTTCTTCCATGAGGACAAATATCCTTCTGAGGCGCCACTGTAATTACAAACCTGCTCTCTGCTGTCCCCTACGTAGGAAACACGCTCGTTCAATGAGTATGAGGAGGCTTTTCAGTAGACAGCGCCACTCTAACACGATTCTTtgccttccacttcctcctcccatTTATCGTTGCAGCCGCTGCCATCGtacatcttatttttcttcacgAAACAGGCTCCAACAATCCCCTAGGACTCAATTCAAACGCAGACAAAATCCCATTCCACCCATACTTCTCTTACAAAGACCTCCTGGGCTTCACAATCATACTCTCAGCCCTCGCAACACTCGCCCTATTCTCTCCAAACTACCTCGGAGACCCTGACAACTTCACACCAGCCAATCCTCTAGTTACCCCCGCCCACATTAAACCAGAATGGTATTTCCTATTTGCATACGCAATTCTACGATCTATCCCCAATAAGCTAGGAGGTGTTCTGGCCCTTCTTGCCTCAATCTTAATTCTTATAGTAGTTCCTTTCTTACACACCTCTAAACAACGAAGCCTAACATTCCGCCCACTATCACAATTCCTATTCTGAACCCTAATTGCCGACGTCGTCATCCTAACCTGAATTGGAGGCATGCCCGTCGAACATCCTTACATTATTATCGGACAAATTGCCTCAGTACTTTACTTCTCTCTCTTCCTAATCTTGATGCCAATAGCCGGTTGACTAGAAAATAAAATACTAAA
   6.767 +p                                HQY^^YXXXXVTUWWWVUVWVPMLLLLKLLNUX_aghnoooollnmfdjmjif^]]\]abcelnkkkknld`a`^_flnooonihijc`_`__dc`cb`bcbeecfcelnkkicefaagijihinlhaahklihdgd_`aa_bjnllooooooolhdffbejib][[XWX^`cbhijhffhnookd`a^]_^bfgfa]]^djnooooonihijjicbaahkebdbekkjjded_^``gklia^_`adedijknolkmkda_`adieadga_`aegiiebdc``djecbimnihcackmmkkjehjnlf]WQPMLLLLLLMU]`dfjknnjhjmjb[YWRQQQQWY^a`cgd\\\bb\XVV`gkkdadjmleabaahlnllonkfklhfa^_`aimmigceggimoooollooolecadijnonkcachinmhfea_``elnlfdijkonjhjmlieihgb`_ad_XXZ]eie\ZZ`cknjiebelkdb`bdjfcimnooonmie]ZZZ]`fa_^_`fdbelnihbZWUTSSSSSV_hjkooookkkdb`aa`hjjkfchhceggileb^WSRQRUUXafhlkjideea_``elnnihhhbcelonjhilhf_][XWX_dd_]]\]]afa__cb`a`hlkca`_ZVVWW[[[^ca_^^`imlieikjkonihijd^\\^`c_^[SRRRQPLLLKIGDCBBBBBBBBBGHLPQSUUVWXXXYZ[\ZXVVUU[^elkecfcelnihejljhjnoomhe^]WUTTSTT]ec__^XXWVVY^`bjlgeddbdddfgdfb```_cdflkloooonihikknlecbgecijga`_bghlicehdgc_`fca`_cdcefhnoolkmihejljiecfb`^__\\YY\diecjmkjicdb^_bjjc_`fhhe^]\[\_decacgfd_^`[YYYYbghhbcejecijkmkca_bifdc_\[VVSRSRQNNOOQQSVW_fecijkjhe_^`\YY`eggacb_`YVVY`chinnihb``_]_``bgijkmh`WQQQRY]]^]^_adaahlnnkjhgceggeknlfcgda[YRRR\djnkjidfb`ZY\dcacfe`^_^\]ZRNHD>;;;;;;;;<<<==>GPUVX]\[VTNKIC;81
   6.768 +p                                w{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zzzyyz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vqqonnnnnnoty}~~~~~~~~~~~~~~~{{{{{|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~yxxxz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{wrmllllkjihffeeedccccbbaaaaaaaaaaabbddeefffggghjjnqrssstty~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{zyxxxxwuuuuwwz|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}~~~~~~~~~~~~~~~~~~~~~~~~~|{ywsnje`_______`abdfgikllmmmmmlkhd`[[Y
   6.769 +p                                $%%'''((((()*.38<@DHJKPTWYZZ^cfijihcacih`]]^_dknonjid\YWVV[\^`imkkkkoonmkeciicfmoomgeeabelkkmjb[[YRPOOOOPWYaimkjgcdaYWW[_cdff_[[_cbadebeig`a`cknollmkfjmnolhdffbekjgb_^[\YTSST]aeca_bbaeb^_bbfedb`ZUNNNNNPQPQWahiaZZY\bbginomfdjnonigb^]__bb`cjmia^_`afhmnkknjb_`aegjecbimnlhaafjjkjiecilmnolecbimnkkkknmlicflnihdgd_^\]`gjkg_XVVY_`bhinnigfe_WWWWUUWWYbgilihd[[YWVVRPOPYbijb_`a`gggb`^^b`beloonkdacigffdhfd~~~~~~~~~~~~~~~~~~~~~~~~~~fhcacdcikhffc`bd`aadcbfb_`\YYYZbaYOFC<97777789<ENSTTUWX`da^^aimkca^_`^^]]ainnkfjlh`YWWWWY_`bdbfdaelnjid[YWVVUUUV_gkjidbd`^_]^__\ZUTTUZ\\`\SJGEDCBBBBAAABKRU^ccc\WWX\_^]_`glnlebac`abbimihimkjgeeegmnigceheaa`ecb`dbddciha`_^^ZVUWW[[[_ffeebelnnkga`^^cjihiljc^\\_b`beicaZWWZaa_[[WVPNMMNNNOTUVX\]`ghcddab`dlnkkke\YXWVV]dflklonjhejlihilia]\\XXWX_``__gg_]]]\ZYVVXXUTUWXXXWUVVVYYZ[^fdb`aa`hjkooonkc`_^aimklookkke_^^^`b`cfcehejihehdba`fglihikfcgimigeihceeciihihd^\\WWX\[YYbgimnnlf`\VUTTV^bgkgeddbeijmkigbb`cgdbefgljif^]]YY\bcb^]^]]_daceigc]\\^``^[[Z[YVVUVYcjjcachhe_^`[YY_cca^`a`ecacjkkkkoollonigb_``dhjkkmh`VPPPQUVVVUVXY__bjmnnkjhgbddbbimoole[YUSMLLMR[cggb[VSSQQRTTUUU[_eec]\\[\\\_b`a_[VTSRSUUVWZ[[[ZYWSOJEA<72.)
   6.770 +p                                "#$%&&&'''''(-16;?CGHINRVZ\\afkotx{|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{{{{{{}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}{yyyy~~~~~~~~~~~~~~~~~~~~}xtsrsstuuv{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~}||}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vrqppqqvz}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}||{yuqllkkkkkkkjifffeeeeeeeffkptxz|||{{{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}{{zxwwxxyyzzzz||~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}xwwwwwxyyz~~~~~~~~~{vvuvv{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zxxxy}~~~~~~zuusrrrrrrrrrqolhggffeddca`_]YXXXXXXXXXXXXWVSPKGB=84/*%
   6.771 +p                                T\aimlecba]\]`bbccejebe`]\[Z[ZZ[[\^_^b^YY\\__cdcilhf`]^^_dca``_ea_acjlebeijlfdjnoonjhikecafhlkgceebdc`a`\[[]bigf`]\WSRRSV[^`iljcflnnllonjehiiiecgcacknoooolgcec\\\dhe`_bggceijnkjhffhmnkc__cbhhhiljd[XVVV]flnnoonhfebehehjnolebdadcacjhabaddcilmia^_`adedijkmia^_^_^]_`bhd_`_XUUSRPPOOPTZ]`ijca_bjmhfacb`cfbdgccaZYUMLLLLKJHHIIKNV[^`fhnnihihab^\[YXWVW^efga_``b^\WVUSSSV[\^`^`a`ea_`chejmllonjde_\]\[\^`hlmigceggimnlfcginonleb`dhiljfkmkkkknmhfea_`aggdfdbfb_`ecba_b\SJGEDCBBAAAABJQS\celkknkebdchmnkknkkjb__bjnooooonkd[[_agdacebekmnoolkmhffdffb`_bjmjidbd`]^Z[[Z^^^ca__dgkiaXNKDDDDCBBBBCEEEEEEEEDDDDDDDEFOX^ghghg`abbea_`cife_``bdknjiechhb\[[ZYXYYZ\]dfcddefib[\\bdijlhfecekkeab^^XVV_cdfkg_ZZ]_c`aa^VSMLLMMOOMMKJECBBCDGHIJKLNPV[]\]\\_^cknkklkhdefb[\YXX^`dceedilhgfejmjb`XXWX[[YZZcjgf`^WVUSSVYXXZ]\ZYXWWY[^fkjc``_^a``gjklfcilihikknlecbgecikieijkkklicfmnjc_`eca`_ccaba`hnolkmigdfb`aa^^YWUPMLKKKKNVZ[`d`]^]^YWWUTTVZ[`_]\ZYYXYZ[Z\]acaa__cbaefglkjhbcejecihgdgca_biihimkd\XWW\^^ZWWZXUUTUWZXWW\^b`\\]```dhecgecilkdadjkkkkonjiebeeaYVOOOQTUUWUOMMMMQRUWYXWWXWY\]]__^ehmkc`_`_edbgecjnolebekkgb_ZXTRQRSVYZZZYWSONLLKHHFD@;;;:::::::;;;;;;;;;;;;::862.)(&
   6.772 +p                                z~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}|yyyy}~~~~~}|yyyz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{zz{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~||{{zz{~~~~~~~~~~~~~~~~~~~~~~|yywutsponnmmlllllmrw{~~~~~~~~~~~~~~~}}}}}~~~~~~~~~~|yxxxxx{|}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zywwvssrqqqruwx}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{vrmlllkkkkkkllmnnooooppqrrrtuz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|{{{yyyyy{{~~~~~~~~~~~~~~~~~~~~~~~~~~~}|{{|~~~~~~}xxwwurrpnjea````````______________``bccdddefglqvz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~}||}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~yuttssstvxxz{|{|{||{{zyxxyz{{{||}}||~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{wsnmmmmmmmllllllmnpqrrrrrrsvwx{}~~~~~~~~~~~~~~~~~~~|wsrpmid`[ZXXWWWWWWWWVTPLKJIHFEDA>98888888888888888888888763/+&%$
   6.773 +
   6.774 +
     7.1 --- /dev/null	Thu Jan 01 00:00:00 1970 +0000
     7.2 +++ b/test/maf-swap-test.sh	Mon May 28 14:53:43 2018 +0900
     7.3 @@ -0,0 +1,19 @@
     7.4 +#! /bin/sh
     7.5 +
     7.6 +try () {
     7.7 +    echo TEST "$@"
     7.8 +    eval "$@"
     7.9 +    echo
    7.10 +}
    7.11 +
    7.12 +cd $(dirname $0)
    7.13 +
    7.14 +PATH=../scripts:$PATH
    7.15 +
    7.16 +{
    7.17 +    try maf-swap -h
    7.18 +    try maf-swap bs100.maf
    7.19 +    try maf-swap -n1 90089.maf
    7.20 +    try maf-swap -n3 ../examples/multiMito.maf
    7.21 +} 2>&1 |
    7.22 +diff -u $(basename $0 .sh).out -